Research Paper on Twitter Essay Example

Research Paper on Twitter Essay Twitter is an informal communication administration and microblogging where individuals can leave their messages, called tweets, with a cutoff size of 140 characters. These are distributed on the client profile page. Clients can buy in to other users’ message stream, which is called â€Å"to follow,† supporters are called â€Å"followers.† All clients can post (tweet) and read tweets through the Twitter site, however many pick rather to utilize outsider applications, as these are intended to take a shot at a PDA, or as an independent application that gives preferable view over the Web program does. It costs nothing to utilize Twitter, yet versatile administrators may likewise send you the bill for utilizing text rub administration for perusing and posting your tweets. Twitter’s home office is in San Francisco, yet workplaces and server rooms are additionally accessible in San Antonio, Texas, and Boston. We will compose a custom exposition test on Research Paper on Twitter explicitly for you for just $16.38 $13.9/page Request now We will compose a custom article test on Research Paper on Twitter explicitly for you FOR ONLY $16.38 $13.9/page Recruit Writer We will compose a custom exposition test on Research Paper on Twitter explicitly for you FOR ONLY $16.38 $13.9/page Recruit Writer It is realized that Twitter was made by Jack Dorsey in March 2006 and propelled in July of that year. The administration had 200 million enlisted clients around the world (September 2011). Of these, half (100 million) who sign into their record at any rate once per month, while 50 million do so every day (September 2011). In 2010, they sent more than 25 billion tweets. Notwithstanding singular clients, there additionally are numerous organizations, administrations, specialists, and associations introducing themselves on Twitter as an approach to contact their clients, clients, and fans. The administration got a lot of consideration during the presidential decisions in the U.S. in 2008, when the presidential up-and-comer Barack Obama’s crusade utilized Twitter and other web based life to contact their constituents. Twitter is additionally an apparatus for protesters in extremist systems to speak with the outside world, just as during cataclysmic events, clashes and so forth when the people set up are quickly ready to give an account of occasions. Individuals who use Twitter utilize some unique articulations. One of these shows is to type the pound sign ) before a word or abbreviation to make it simple to discover messages about this. Such words are known as a â€Å"hashtagg.† Large associations, occasions, and social developments regularly have their own hashtagg to assemble data about them. Twitter accounts are alluded to likewise with an at sign (@) before the username. Spreading or sending somebody else’s tweet is called â€Å"to re-tweet.† An early method to â€Å"re-tweet† was made by composing RT followed by an at sign and the first author’s account name. The current inherent approach to â€Å"re-tweet† was presented in November 2009. Understudies, who are searching for the assistance recorded as a hard copy their exploration proposition on twitter, can utilize free research papers on various subjects. These free model papers can be a fantastic wellspring of applicable information, if appropriately composed. Is it accurate to say that you are searching for a first rate custom research paper on Twitter subjects? Is classification as critical to you as the high caliber of the item? Attempt our composing administration at EssayLib.com! We can offer you proficient help at reasonable rates. Our accomplished PhD and Master’s scholars are prepared to consider your littlest requests. We promise you 100% genuineness of your paper and guarantee you of dead on time conveyance. Continue with the request structure: It would be ideal if you don't hesitate to visit us at EssayLib.com and get familiar with our administration!

Compare and Contrast the Chinese and Russian Revolutions Essays

Investigate the Chinese and Russian Revolutions Essays Investigate the Chinese and Russian Revolutions Paper Investigate the Chinese and Russian Revolutions Paper China and Russia had different similitudes and contrasts during the mid twentieth century. They were diverse in the part of objectives as Russia was profoundly worried in making everybody proficient to encounter crafted by Marx, Lenin and Stalin by and by while neither the Chinese socialist gathering nor the Kuomintang thought much about education for the general population. Another distinctions was the portrayal of the Russian transformation by World war 1 prompting the rebel against a decision Tsar while China, was not influenced by the war was all the more a common war between the patriots and Mao’s workers. All things being equal, the two countries wound up with Communist upheavals, following the low class administering conviction. During the mid twentieth century, the Russian progressives needed every one of its kin to be proficient as to understanding by perusing crafted by Karl Marx, Lenin and Stain direct. In general they were extremely effective in expanding the proficiency rate all in all. This was conceivable on the grounds that following the upheaval, training was significantly redesignd in the spending on well known instruction. Free eduction was requested for all kids from the ages of three to sixteen years of age just as the duplication of schools inside the initial two years. Coeducation was additionally forced as to dispose of sex segregation and for the government assistance of the entire society. Anyway in China, the transformation didn't generally think about instructing and training for their residents but instead concentrated fundamentally on supplanting the current arrangement of government and its ruler with one headed up by the pioneer of the insurgency, Mao Ze Dong. Another distinction between the Russian and Chinese unrest was that the Russian insurgency was affected a ton by the principal universal war, while the Chinese upset was immaculate by it and still battled for indistinguishable convictions from the Russian transformation. The Russian upheaval was featured by the topple of Nicholas II which was welcomed on before the finish of the principal universal war. In an unexpected way, the Chinese insurgency was not influenced by the primary universal war and was started by the Marxist thoughts of the regular workers having the option to run the show. Despite the fact that the principal universal war was not a reason for the insurgency, Mao Ze Dong’s laborer armed force and Chiang Kai’s patriot armed force despite everything battled until Mao’s powers vanquished the patriots in 1949. The significant similitude between the Russian upset and the Chinese insurgency would be that the two transformations cleared the way for the countries to become Communists. They were both driven by appealling pioneers Lenin and Mao Ze Dong, who had the option to join the individuals into the upheaval. Both had comparative objectives and results as the two of them focused on the regular workers, Proletariats, to manage against the decision class. The two transformations additionally intended to setting up a state possession in their nations just as expelling any sort of disparities inside the country. Both winding up as socialist countries, the Russian upheaval and the Chinese upset were formed by various starts and expected to arrive at its objectives through various techniques however strived for a comparative objective propelled by the Marxist thoughts of the Proletariat class to run the show.

What Makes Your Corporate Identity Unique (Hint Its Not What You Think)

What Makes Your Corporate Identity Unique (Hint It’s Not What You Think) How many logos of famous companies are you able to draw? Probably quite a few since these visual representations of the company have become a core part of our daily lives as the products themselves. We are constantly surrounded with different visual cues about businesses â€" videos, images and website templates are part of our lives.But how do companies ensure their corporate identities or these visual representations of their business are correct and authentic? Let’s explore what corporate identity is, the biggest mistake you can make thinking what separates the best from the rest, and what is actually behind a strong and unique corporate identity. WHAT IS CORPORATE IDENTITY?Let’s first be clear what corporate identity is before we start analyzing how it can be unique. You can’t truly create something unique unless you know what you’re creating in the first place. If you look up ‘corporate identity’ in the Business Dictionary, you find the following description:“Combination of color schemes, designs, words, etc., that a firm employs to make a visual statement about itself and to communicate its business philosophy.”Quite simply, your corporate identity tells you and others what your business is all about â€" the specifics that make you different from all the other businesses out there. The dictionary definition goes on to state,“corporate identity is ‘out there’ sensory-experience conveyed by things such as buildings, décor, logo, name, slogan, stationary, uniforms, and is largely unaffected by its financial performance and ups and downs in its fortune”Your corporate identity can essentially be either a s trong on â€" creating instant recognition among consumers â€" or a weak one. However, as the above suggest, this doesn’t necessarily always mean your business itself is doing bad or well in terms of its profit-making ability. Corporate identity is a physical expression of the essence of the company.However, as I’ll explain later, it shouldn’t see completely separate from the other representations of the idea of the business â€" what the company is about should also be highlighted through the communication and behavior of the business.Furthermore, corporate identity shouldn’t be seen as a layered structure. The internal and external representations of what the philosophy must be same â€" the customers have to experience the same corporate identity to the employees and other stakeholders.The idea of corporate identity and the need for businesses to develop their own unique voices is not a recent phenomenon. It developed as a concept in the 1960s when the corporate landscape ch anged from individual industrial companies to multi-national corporations on a global scale. It became more important for a business to stand out from competition â€" there had to be identities that told consumers the kind of story or business ethos they are buying into.By the 1970s, the concept of corporate identity was on everyone’s lips and advertising consultants became a core part of business development. The idea of a strong and unique corporate identity became central to corporate planning and successful implementation of corporate identity strategy was considered a major reason some companies succeeded while others failed.Below is a video of how Virgin developed its corporate identity under Richard Branson. This is great for getting a grasp of what corporate identity is and prepares you well for what I’m about to say in the following chapters. THE SINGLE REASONS YOU SHOULD CARE ABOUT ITSo, why does corporate identity have such a hold on people’s imaginations? Why are b usinesses willing to spend money on creating a corporate identity?There is essentially only one reason a business should care about corporate identity and that’s performance. A Strategy survey back in 2013 peered into the world of corporate identity and made a series of interesting findings. For instance, according to the respondents, developing corporate identity strategy is problematic because most companies have too many strategic objectives. But the key finding in terms of corporate identity was how companies with a strong corporate identity outperform those without one by 25%.While your financial performance isn’t always directly linked to your corporate identity, by ensuring you have a clear identity, you create a strong base for succeeding and growing.If you think of the biggest and most successful companies, you instantly think about their strong corporate identities â€" Apple, Coca-Cola and Google have all been rather good at creating a visual representation of their bu siness philosophy and made it stick with us.When you scratch deeper, you notice that the ability to outperform comes from the three big advantages a strong corporate identity will provide for a business. These can be divided into three key benefits:Enhanced consumer loyalty â€" A good corporate identity boosts performance because it can keep customers more engaged with your business. Customers have their own identities and a good corporate identity speaks to those in a way that aligns these two separate stories or philosophies together. The corporate’s emphasis on sustainability in a sea of other identities that are about something else can help consumers with like-minded ideas to stick with them. Customers who subscribe to your corporate identity will feel part of the story â€" they don’t want to conduct business elsewhere.Strengthened corporate experienceâ€"There is also an emphasis on the whole corporate experience when companies focus on building strong identities. You align not just the external images with the company philosophy, but also the behavior and communication of the message. The consumer doesn’t just experience the identity by looking at the logo but also feels the identity when shopping the products, contacting customer service or using the product or service. Corporate identity can help create a strong and strategic approach to conducting business.Structured corporate personaâ€" Every business benefits from having a specific corporate person, which is essentially what corporate identity is about. It’s the impression we have when we hear about a business â€" shaped by what we’ve experienced and what we’ve heard. Just like you have an impression and persona build about your friends and family, you’ll also have corporate personas in mind when you think about your favorite brands.It is these three building blocks that help a business compete and to stand out in the crowd. By creating a strategic approach to implementing your busines s ethos, you strengthen the areas that contribute to performance â€" you obtain and retain customers better, you streamline your services to provide better service, and you help build a reputation.THE BIG MISTAKE TO AVOID WITH CORPORATE IDENTITY Source: Gismodo blog postWhy is it then that businesses often fail in creating successful corporate identities? It happens when the definition of corporate identity is taken to mean purely the visual statement of the business philosophy and most importantly purely equated with the logo. Too often businesses are transfixed with the logo, with purely the visual design and feel of the logo at the core of their attempt to be unique.What’s forgotten is the core message â€" the reason why your logo represents your business. If you’re doing corporate identity right, you will always align your behavior and communication, together with the visual representations, with your business philosophy. You need to have the “what we are” sorted before you can move on to “how we look visually”. By focusing on the logo, you’re not focusing on ensuring the corporate identity tells the story of your business â€" you’re just creating an image without a story or behavior.Furthermore, it’s a lso harmful to focus purely on the logo when your business will be represented visually in so many more ways. When you visit Apple’s website, the corporate identity isn’t just evident in the logo â€" in fact, you don’t really even encounter the logo as a focus point on the pages. The corporate identity of Apple is much more than just a logo.Think, for example, how TV shows sometimes need to remove logos from laptops for sponsorship reasons. When you tape out the image of the half-bitten apple, you don’t forget the computer is an Apple product. You can see it from the way the product is designed.The same applies to most businesses with a strong corporate identity. You could remove Coca-Cola’s logos from its bottles, website and even ads, yet you’d still know it’s that specific brand and you’d know the story, the philosophy. If I put a blindfold on you and take you to a fast-food joint, you’d know we’re at McDonald’s even if the traditional logo of the golden M o n a red background is removed.Corporate identity goes wrong when people simplify it to a single image â€" when we compress identities into a single representation. But you can’t and you shouldn’t narrow an identity, right? Businesses are a bit like people; we couldn’t create a stamp of our identity and think it’s going to work every time.A logo alone is insufficient in telling a story and representing our corporate ethos â€" identity is about how we look (not just our clothes, but also our makeup), how we talk, how we behave and how we align all of these.The big mistake to avoid with corporate identity is treating these three things as separate and hoping to create an identity simply through a single representation: a logo.HERE’S WHAT ACTUALLY MAKES YOUR CORPORATE IDENTITY UNIQUEIf you want to create a unique corporate identity, then you must focus on aligning the three key areas of corporate design, corporate behavior and corporate communication together â€" you need to e ssentially create a package of visual statements that are sprung from the business philosophy and which relate to the other aspects of your company. You move on from staring at the logo, to truly realizing what your identity is about.To nail down your corporate identity and to find the authentic voice that tells and visualizes your business idea, you need to ensure the three areas are not in conflict with each other. Now, let’s look at each area closer and see how each aspect helps build your authentic voice:Corporate designCorporate design is exactly what most people mistakenly equate with corporate identity. It is about the logo â€" the visual images you use for your business. Corporate design deals with business cards, website templates, font colors and other such visual representations of your business. It is crucial for corporate identity because it is often the first thing people see and interact with. When you search for shoe retailers, you click on the website and the logo is often the first thing that stares back at you.It is the immediate part of corporate identity and it does have a huge impact on how customers view your business. While the logos and other visual images are crucial in creating this first impression, they aren’t the only things that you should focus on, as the above has hopefully highlighted. Nonetheless, a corporate design is the core of your corporate identity and the starting point for creating the visual image for your business.Corporate behaviorHowever, your corporate identity is also strengthened through your behavior. Corporate behavior includes things like how employees are treated and the leadership styles the management uses. These and others like that refer to the internal behaviors, but corporate behavior can also be driven by external behaviors such as how you treat customers, what is your relationship with the media and so on.These behaviors can impact your corporate identity and help the corporate design have an im pact. For example, if you maintain an open and honest relationship with the media, you can strengthen your corporate identity and create a brand based on transparency and communication.When the stories people read about your business are highlighting this image, the actual visual representation â€" your logos, your colors and your fonts â€" becomes associated with the behaviors. Your solid corporate design links with corporate behavior, creating a unique experience of your identity.Corporate communicationSimilarly to the above, your corporate communication â€" the way you speak to customers, advertise your business and interact with the media â€" has a strengthening impact on corporate identity. Your advertising slogan can enhance this transparent behavior â€" We believe in your right to know! â€" and be perfectly aligned with your clear logo.Communication will also happen in the form of your press releases or internally through things like staff meetings. If you can have these comm unication channels represent your business philosophy and deepen the behaviors within your organization, you have a direct impact on the identity.Essentially, you can’t just talk the talk; you also need to walk the walk. Communication must match your behavior and both of these have to match your corporate design. By aligning these three aspects together and linking them with your business philosophy, you can enjoy from a strong and unique corporate identity.You’re not doing something visually that you think appeals to customers, but rather representing your authentic voice as a business. You’re creating a more fulfilled representation of your business â€" the way it looks, behaves and communicates.HOW TO CREATE A UNIQUE CORPORATE IDENTITYSo, when you are looking to create a unique corporate identity that will stand out from the rest, you must focus on four key steps. These will help you align the three building blocks of a strong corporate identity and they ensure your focus i s on authentic and representative identity â€" not just a flashy logo.Step 1: Establish your unique value propositionThe first step deals with your business’ unique value proposition. It’s the most important question any business will ever be asked about: What is your company about? If you’re not quite sure how to answer that, then you definitely need to do a lot more soul-searching. You can’t start to run a successful business or form your own unique identity if you don’t know your brand.You definitely need to have a business plan, a mission statement and a vision for future. If these things are still lacking, you should get started by watching the below video and start finding the underlying cause and objective of your business. The whole idea of this first step is to identify the reason you’re unique. Not just in terms of how you differ from competition, but in your story and objective. A business hardly has the same objective as another business in the same industry â€" there is something there in your product, your service and your objectives that separate you from the rest.Before you can start building your corporate identity and begin the visualization of your business idea, you must be clear what this unique value proposition is about.Step 2: Establish your unique value propositionAfter you’ve cleared the basics, you must move deeper into understanding your business and the brand. You need to determine what’s your spot in the marketplace and who are the people that use your product and service.If you can analyze the most important drivers for growth, you can start identifying the ways in which your customers currently view your business.Knowing your brand will reveal your competitive edge â€" it will deepen your understanding of the current corporate identity and how it aligns with your business philosophy.Step 3: Set the correct toneNow that you have the building blocks for your identity, you start to visualize it â€" you find the voic e that represents your brand and your unique value proposition. Remember the following:Your brand’s voice must be distinctive from the competitors, it must resonate with your customers, and it has to be consistent in terms of your business values and objectives.Since you are now focusing on the corporate design â€" the logos, the colors, the social media templates and so on â€" your focus must be on finding the design that keeps the above in mind. You want to think about your customers and consider the kind of images, colors and fonts they would find visually attractive.These must be then considered in relation to your business philosophy â€" does it all fit together and create an authentic look and feel of your business?Step 4: Be prepared to analyze and refine your identityI was kind of lying earlier when I said there is one big mistake companies make with their corporate identity. There are actually two major issues businesses. The other, i.e. relying just on your logo, has now hopefully been solved with the tips above.However, the second is something different. It is about the failure to change or refine your brand identity. Businesses are terrified of this mainly due to a few famous examples of re-branding that didn’t work. Nonetheless, corporate identity shouldn’t be considered something set in stone and irreplaceable. Corporate identity develops over time, just like the competition around you.Just like you must be constantly looking to refine your products or service, you naturally also need to analyze and refine your brand. Since corporate identity is a culmination of the three elements, design, behavior and communication, changes in one of these means that there needs to be adjustments in the other two.Remember to constantly revisit your corporate identity and its building blocks to ensure your message is still aligned, it still resonated with the consumer, and it has stayed true to your business philosophy.As an example of small refining, look at the three logos. They have all held on to the distinct identity and feel, while still updating the look to something a bit more modern and perhaps refined in terms of what customers are looking for in today’s day and age. Source: Brand Matters websiteTHE KEY TAKEAWAYAfter you’re finished reading this post, you should have taken in the following information: your corporate identity does not equal to your logo. Unique corporate identity is much more basic than that â€" it’s the alignment of your business idea with how it behaves and communicates and represents itself visually.It’s about putting your business’ unique value proposition at the centre of everything you do. A good corporate identity is one where the visual statements tell the same story as the way the business behaves and communicates with its customers, stakeholders and employees.

Singapore Fast Food War - 2395 Words

1. Conduct an IMC context analysis for one of the following; McDonald’s, Pizza Hut, or KFC. This case study will analyze customers, competitors and communication of McDonald’s because it is one of the most well known brands worldwide. CUSTOMERS McDonalds opened the first restaurant in Singapore at Liat Towers on Orchard road in October 1979. Its aim is to offer friendly fast food in a fun environment for everyone to enjoy. Its target markets are families, because children want to visit McDonald’s as it is a fun place to eat, working people who are looking for a quick meal because of their busy schedules, and teenagers who are looking for the value for money menus and free internet access available in some restaurants. McDonald’s target†¦show more content†¦The target of the monopoly campaign was to obtain repeat customers (Writer, Staff 2009). For the current promotion, McDonald’s offers free toys with the purchase of happy meals â€Å"Hot Wheel Go for It!† for boys and â€Å"Barbie in the Pink Shoes† for girls to collect. In addition, McDonald’s also provides on going promotions such as birthday parties, gift certificate and discounted coupons for customers of all ages, which aid to support sales promotion (McDonald’s Singapore 2013). Public Relation According to McDonald’s press releases (2013), the current public relation programs for year 2013 are â€Å"The World’s Largest Ever Breakfast Giveaway†, â€Å"Customers And Staff Gather to Bid Farewell to McDonald’s Marine Cove Restaurant†, and First â€Å"Home-Away-From-Home For Families With Sick Children Opens In Singapore.† 2. Identify the target markets that are best suited to each of the following: McDonald’s, Pizza Hut, and KFC McDonald’s The best suited target markets for McDonald’s are people of all ages and demography such as parents with children who visit McDonald’s to give the children a treat, kids who want to visit McDonald’s as it is a fun place to eat, a business customer who visits McDonald’s to have a quick meal and rush to go back to work and teenagers who are attracted by the sever menu they can afford and the free internet access available in restaurants (McDonald’s Corporation 2008). Pizza Hut Upon reviewing Pizza Hut advertisements in Singapore, theShow MoreRelatedFast Food War in Singapore673 Words   |  3 PagesFast food war in Singapore Q1. Conduct an IMC context analysis for one of the following: McDonalds Pizza Hut, or KFC. Consumer KFC (formerly known as Kentucky Fried Chicken) has proven to be more popular in East Asia than many beef-based fast food chains, partially because of regional preferences that favor chicken. The parent company of KFC, Yum! Brands has made it its mission to tailor menus to local tastes in China and will undoubtedly employ this strategy in India, as well (Grgurich 2012)Read MoreDesign Marketing Cover for Pringles Essay1649 Words   |  7 PagesPringles A. http://www.fatsecret.com/calories-nutrition/pringles - Normal - Small - Stick - Promotion [star wars, speaker, Iphone App] A. Analysis - SWOT - PEST - 5P people/product/place/price/promotion - Objective B. Target Audience[MIN] C. Brand Positioning [with 3 brands] - USP – What Pringles have that other company don’t have D. Problem of Pringles in Singapore E. Solution F. Reference Pringles strategy[Mission and Vision] In 2012, we continued to execute a strategyRead MoreWhy Did Japanese Chose Pulau Ubin As Their Divergent And Went Attacking From The West And Not East?2305 Words   |  10 PagesThe British had confidently predicted that the Japanese would attack from the sea. This explained why all the defences on Singapore pointed out to sea. It was inconceivable to British military planners that the island could be attacked any other way – least of all, through the jungle and mangrove swamps of the Malay Peninsula. Therefore, the defence on the North West of Singapore was weak as the Australian forces deployed there was small and the terrain have prohibited the allies in their constructionRead MoreMcdonald Marketing of Service12670 Words   |  51 Pagesmarketing plans which have made them become world leading fast food restaurants besides Subway. By implementing every of the marketing strategies based on their five marketing objectives which are profitability, consumer satisfaction, qual ity service , community outreach, and reputable image, McDonald’s has been a very demanding fast food restaurants which operates with 30,000 restaurants over the world . Moreover, situational analysis of Singapore which has been supporting McDonald’s business will alsoRead MoreManhattan Fish Market Expand to Australia2592 Words   |  11 PagesAustralia’s fast casual restaurant industry and the level of competition of Manhattan Fish Market were in the new market, Australia. Through the brief overview of Australia’s Political, economic, Social, Technological and Environmental factors to gain a better understanding of the external environmental factors of Australia. With the application of Michael Porter’s three out of five forces of the model, 1. Bargaining power of buyer 2. Threats of substitutes 3. Intensity of rivalries in fast casual diningRead MoreThe Concept of Advanced Civilization Led to the European Conquests on the 16th and 17th Centuries1367 Words   |  6 Pagesworld in 1519 was the Aztec city of Tenochitlan. With a population of 250,000 people, it was organized with market trade and religious duties. Numerous temples were built that were devoted to their Gods and nature, particularly the sun which created food. It was believed that the sun obtained its energy from human blood, so there were frequent sacrifices of all types of people. Over 20,000 people each year. They had conquered much of the neighboring Tlaxcala’s territory, and used them for sacrificeRead MoreThe Eyes Of American Corporates Essay1413 Words   |  6 Pageschains don’t want to fight old-time wars anymore. They want to make just-in-time deliv eries of goods and services† (par 17). This means that such countries are too concerned with their spot in the supply chain to think about losing their privilege to levy a war. The Syrian is very local-oriented: people like the way things are, and continue to refuse giving into international pressure of finally getting a McDonald’s. People still embrace their language, their food, and their religion. In fact, theRead MoreObesity And The Rate Of Children Obesity1585 Words   |  7 Pagesstate present a plate with varieties of food, with the main courses running from mac and cheese, to chicken nuggets, burgers, French fries. The meal usually come with fruit cup, milk, canned beans, and are not appealing to the eyes. While some plate of food were more nutritious than others, it is no doubt that these students consume hundreds of empty calories every day, from the high sugar fruit-cup, to the main courses simply made of processed, fast-food. Another reason that may contrib ute to theRead MoreThe Republic Of The Philippines1570 Words   |  7 Pagesfind work forcing the citizens without a place to go to live in crowded slums making homes out of any material scraps they can find. Most of these homes do not have stoves or basic cooking utensils, so families reside to eating inexpensive street foods or ready to eat noodles with what little money they do have, all at the cost of their health. Similar to other countries a lot of these families move to the urban region in pursuit of happiness and a better way of life. Instead, they end up movingRead MoreIssues in the Malaysia Tourism Industry2555 Words   |  11 Pages5.1 Issues in the Malaysia Tourism Industry Malaysia tourism obtained the fast development as a result of it own superiorities in natural and cultural travel resources as well as governments vigorously support. It has become the countrys second biggest source of foreign exchange and the third largest economy sector. But under this excellent prospect, we instead should have a more sober understanding to the tourism’s vulnerability and the issues in the Malaysia travel industry to continue developing

The Purpose of Education Essay - 687 Words

Purpose of Education In almost every culture and in all parts of the world, getting an education is valuable to a person’s future. But what is it that makes education so valuable? What is the purpose of an education starting from the early stages of a child’s development into adolescents, and from adolescents into adulthood? There are many different reasons why a K-12 education is important. Although Kindergarten seems like a place where kids color all day and have recess, there is actually a very intense learning process in effect. Not only are those children learning how to socialize with other children of their same age group, but they are also being taught kindliness, discipline, how to respect there†¦show more content†¦She yelled at me in front of the class which really embarrassed me, however, I learned that stealing was wrong; and from that day on, I never stole anything again. The first eight years of a child’s education is where he learns the basics of everything. This is where a child learns values, how to read and analyze material, how to think critically when solving math problems, use different strategies, take timed tests, write basic five paragraph essays, and so on. Without these first eight years of education which carry a child into his or adolescent phase, a child will not be able to reach his full mental development. As a child grows, his intellect and ability to reason and make educated decisions should reach higher levels. Once a child graduates from elementary school and goes on to high school, he or she is already molded into the person he or she will be for the rest of his or her life. Sure all kids become more mature within those four years, but their values are still the same, and in some cases even stronger. In most circumstances, a child will use what they learned in the past to make decisions inhe future. High school, however, is important for other reasons as well. High school is the very last step before a student can enter the realm of higher education. Therefore, high school is essentially what prepares a student to go on to bigger and better things. High school is whereShow MoreRelatedEducation : Purposes Of Education Essay1311 Words   |  6 PagesFall 2015 Purposes of Education The vocational purpose of education refers to the information and abilities students master through their learning experience in schools. In other words, the main goal of this purpose is to prepare literate and economically aware adults. In reference to early elementary school years, skills that students must master are basic addition/subtraction, memorization, learning to read, and basic sentence writing. Mastering these skills are an important piece of the economicRead MoreThe Purpose Of Education1038 Words   |  5 Pagescommon good refers to the advantage of all people in society. The purpose of education is to prepare students with the life skills they need to be better citizens when they become adults. Most schools promote the idea of the common good in their mission statements. My school mission statement is, â€Å"The mission of the Wadsworth City Schools, in cooperation with families, school personnel, and community, is to provide an education in a safe environment t hat will enable all students to reach theirRead MoreThe Purpose Of Education1041 Words   |  5 PagesEducation has always played an important role within societies and still continues to do so. Education certainly has numerous purposes. From my point of view, the purpose of education is to transfer a wide range of knowledge to students in various fields in order to pursue life ambitions such as job opportunities, research and to prepare students for life and enhancing their current abilities. Education will build and develop the necessary skills required in order for individuals to communicateRead MoreThe Purpose Of Education1918 Words   |  8 Pages1. What is the purpose of education? The purpose of education is to develop young minds with the values and principles that are required of a being a productive and thriving citizen. An education gives children the ability to think and reason critically. It is extremely important that children are educated to think for \right and wrong. For example, children that do not graduate high school. The number of adults in correctional facilities with high school diplomas versus those without are very unbalancedRead MorePurpose of Education Essay669 Words   |  3 PagesEssay: The Purpose of Education Everyday we go to school to receive our education, but what is the purpose of education? Dr. Martin Luther King Jr.’s speech, â€Å"The Purpose of Education† and Frank O’Connor’s short story, â€Å"Christmas Morning,† both discuss what is the purpose of education. The purpose of education is to acknowledge not only one’s intelligence, but also one’s character, provide one with the ability to make decisions and achieve their goals. One of the purposes of education is to acknowledgeRead MoreThe Definition And The Purpose Of Education1484 Words   |  6 Pagesthe definition and the purpose of education. I first define education as a particularly social activity through the integration from different views. Then I introduce the education in China, in the process of quality education reform, which can be taken as a shift from the utilization of education. The current situation, however, is unsatisfactory and problematic because the reform seems to be just a formality. Partially as a solution to this, I describe the purpose of education to focus on the preparationRead More The Purpose of an Education Essay548 Words   |  3 PagesThe Purpose of an Education Many of today’s youth do not see the purpose of education. Students, however, have goals and ambitions they want to fulfill when they reach adulthood. They want to be the lawyers, doctors, teachers, computer analysts, and government officials. They want to have salaries that exceed $50,000 so they can drive the BMW(s) and Lexus(es). To fill these positions, young people need to meet the qualifications and they will see that it fundamentally comes down toRead MorePurpose of Higher Education1129 Words   |  5 Pagesdifferent theories for the purpose of higher education in The New Yorker’s article named, Live and Learn: Why We Have College. Menand (2011) claims that the reasons for a college education are meritocratic, democratic, and vocational. These theories are great models for the purpose of higher education in our culture at different points in our history. Our colleges and universities conduct instruction with clear and definite intentions. The instit utions of higher education adopt certain techniques designedRead MorePurpose Of College Education1041 Words   |  5 Pageshave a college education because they do not consider important factor when it comes to make an important choice in this case, your career. Today in America the purpose of a college education can be interpretive in different ways and meaning depending on the position of each person in the articles,â€Å"Post-College Success Not All About the Money† and â€Å"Higher Education and the â€Å"American Dream†: Why the Status Quo Won’t Get Us There† states and support that the purpose of a college education is to find yourselfRead MorePurpose Of College Education863 Words   |  4 Pages Education is the understanding of knowledge, skills, and moral values. It is essential for the growth and development of students. It serves as the direction of the mind of a young adult. A college education is an important stage because it helps students understand and appreciate the importance of education in the society. It is an optional stage of a formal system of education that offers vocational learning. The college experience teaches the young generation to work by preparing them psychologically

Study Skills Assignment Free Essays

string(65) " also given in the following form \(work break down structure\)\." Table of Contents Task 11 1. Introduction:2 2. Research strategy:2 3. We will write a custom essay sample on Study Skills Assignment or any similar topic only for you Order Now Data collection methods:3 3. 1Primary data collection method:3 3. 2Secondary data collection method:3 4. Resources/Data Access:4 5. How and Why:4 Task 25 1. Project Plan:5 Work break down structure (WBS)6 2. Understanding the instructions:6 3. Managing Time Effectively As a Post Graduate Learner:7 4. Gant chart:7 5. Collection of information:8 6. Write a more detailed plan:9 7. Getting Started, Editing the work, proofreading the draft and the final edit9 Task 310 Critical Reflection Report:10 References:13 PLANNING REFLECTING AT POSTGRADUATE LEVEL Task 1 Develop a research strategy explaining EXACTLY how you will find relevant academic material to help you with THIS SPECIFIC ASSIGNMENT, i. e. specific search ‘strategies’ ‘search terms’, which databases journals you will query, how why, etc. 1. Introduction: An assignment is a task that is given to testify a student’s knowledge regarding a particular subject or topic which he/she is asked to produce as a part of his/her academic course and this assignment is usually assessed. However, there are different kinds of assignments given during the course such as theoretical assignments, practical assignments containing theory and some practical approach by conducting primary research for example, development of business plan (Bell, 2002). The student/researcher when given an assignment should first develop an understanding of the contents of the assignment and then should develop a research strategy according to which he/she can start and complete the given assignment. Apart from developing a research strategy for the assignment another important which needs to be considered is the mode of data collection and the sources from where the data for the particular assignment could be gathered. Further the writer needs to keep in mind the length/word count of the assignment, the kind of report required whether an essay is asked to write or a report that might be containing headings, diagrams, charts and graphs (Bell and Chan, 2005). 2. Research strategy: A research strategy is a plan of action that gives direction to your efforts, enabling you to conduct research systematically rather than haphazardly† (Bain, 2000). The following research strategy will be employed to conduct the current assignment: * Thorough study of the topic and related subjects prior to starting the assignment. * Understanding the requirements of the assignment * Thinking of such ideas that can make the assignment different from others. * Inquiring yourself as what do I want to do in the assignment? * Collecting data through browsing different sources. Locating a specific piece of information * Retrieving all the related material on the given subject Further, for the current assignment the research strategy adopted by the writer would be based on the requirements of the assignment. As the assignment requires the development of such a strategy which will help the writer to find the academic material for the current assignment. However the following ways will be utilized to collect data. 3. Data collection methods: The most widely used data collection methods are: * Primary data collection method * Secondary data collection method 4. Primary data collection method: Primary data is usually present in raw form or in the original form which the researcher collects by employing different methods such as questionnaire, observations, and focus groups, personal and telephonic interviews. This kind of data is not used previously in any research or by anyone. Howeve r for the current study this kind of data collection method would not be required as the current assignment does not require any such data that requires the development of questionnaire, conducting interviews or observations (Kumar and Ranjit, 2005). 4. 2 Secondary data collection method: This kind of data already exists in published and non published form, however secondary data is mainly comprised of compiled statistical reports, financial reports, news, articles and journals which could be accessed through different research engines such as Google and through various sources such EMARLD, Mintel, EBSCO, Jstor, Lexis, Key Note, Willey Interscience and Nexis and also through books and web pages. However for completing the current assignment secondary data collection method will be employed and data will be collected through different resources (Dawson, 2002). 4. Resources/Data Access: The information gathered for the current assignment were from different resources such as Journal of Educational Administration, International Studies in Educational Administration, further few books were also employed to gather information such as Developing and applying study skills. London: Chartered Institute of personnel and development, Project management: a systems approach to planning, scheduling, and controlling, edition. 9th Canada: John Wiley Sons, The 7 habits of highly effective people. United Kingdom: Simon Schuster UK ltd and Research Methods for Business Students. 5th ed. England: Pearson Education Limited (Saunders et al. , 2003). 5. How and Why: The journal of educational administration was found by using EMARLD, which is an authenticated academic resource and students have access to it through the respective university/college library. Further the international studies in educational administration were also found through EMARLD. The different articles and journal were found by entering the key words of the subject in the search bar and the search engine will find relevant articles. However the different books were accessed through Wiley Interscience such as Developing and applying study skills. London: Chartered Institute of personnel and development, Project management: a systems approach to planning, scheduling, and controlling, edition. 9th Canada: John Wiley Sons, however few web pages were also accessed through Google Scholar (http://scholar. google. com). These resources were employed due their academic authenticity as well as they are properly published resources bearing proper author name and the year they were published (Saunders et al. , 2003). Task 2 1. Project Plan: The project plan for the current assignment is simple and is presented as follows: * Understanding the instructions What is the question actually asking for? * Have a quick plan before starting * Collection of information * Use of other authors’ work * Write a more detailed plan * Getting started * Editing the work * Proofreading the draft * The final edit The project plan for starting and completing this assignment is also given in the following form (work break down structure). You read "St udy Skills Assignment" in category "Papers" Work break down structure (WBS) 2. Understanding the instructions: The first and foremost step after getting any kind of assignment is to read it carefully and understand its instructions and for instance if there is ny ambiguity it could be cleared at the beginning so that the assignment could be completed with clear instructions. In case of the current assignment the writer read the instructions and discussed it with the tutor to have a more understanding of the requirements. Moreover, the question/query being asked was fully understood and a quick plan as how to start the assignment was made which included work break down structure and Gantt chart. This further enabled the writer to estimate the time required for the current assignment (Kerzner, 2006) 3. Managing Time Effectively As a Post Graduate Learner: Time management refers to the development of processes and tools that increase efficiency and productivity† (Ward, 2012). Fur ther it allows a person to mange time effectively and allocates right time to right activity. Managing time effectively allows the individual to prioritize activities according to their importance and allot specific time slot to that activity. Like wise in order to mange time effectively and after having a complete understanding of the instructions the writer was capable of allotting the time required for the current assignment. As time management is critical and important factor in completion of the assignment (Mancini, 2003). 4. Gant chart: The Gantt charts are rigorously used as a project planning tool that could be utilized in order to present the timings of activities that are required to be done in a project. However, Gantt charts are very simple and easy to make and they are widely used by project managers for all type of projects (Durfee, 2008). The following Gantt chart is base on the work break down structure given above. The following graph shows the work load distribution over the week days. It is evident from the graph that more time was given to the assignment on the weekends that is 25 percent on Saturday and 28 percent on Sunday; however the distribution of work is done as per the following percentages on each day. 5. Collection of information: This is the most important activity in making an assignment as the assignment is produced using information gathered from different sources. However, for the current assignment different sources were utilized in order to get good quality academic article, journals, books and web pages. These sources include Journal of Educational Administration; International Studies in Educational Administration, further few books were also employed to gather information such as Developing and applying study skills. London: Chartered Institute of personnel and development, Project management: a systems approach to planning, scheduling, and controlling, edition. 9th Canada: John Wiley Sons, The 7 habits of highly effective people. United Kingdom: Simon Schuster UK ltd and Research Methods for Business Students. 5th ed. England: Pearson Education Limited. An important point while gathering information was to consult the core books and such sources that have been recommended by the tutor, apart from these additional information was also gathered. In case if the writer can not get good articles, the best way is to look at the reference list of any one article and the writer can search for the articles and books used by the author of that article. Another important point to be considered is that while collecting information the writer must be sure the material being collected is relevant to the topic he is searching for, otherwise this can distract the writer from the main topic (Covey, 2004). . Write a more detailed plan: In this stage, after collecting the information the writer needs to select the information which is to be included in the assignment and also the order in which it will come. At this stage the writer has to plan how to organize the information and his thoughts for this he may have to write a list, draw flow diagram, an d make charts and tables in order to arrange the information in a symmetrical and presentable form. This practice helps the writer to save time and the assignment will have a flow rather than jumping between different topics. Thus making a detailed plan/structure of the assignment will helps the writer to have a more balanced assignment. 7. Getting Started, Editing the work, proofreading the draft and the final edit After making the structure and flow of the assignment, it is easier for the writer to start the assignment; however, the assignment is usually started with an introduction which is a brief explanation of the topic and this portion gives an insight of the assignment; what is it all about. An important thing which must be remembered that every time the writer makes some notes from a source he/she should keep the reference of the source and it will prevent the assignment from plagiarism and will save time at the end as well. Similarly the writer should make necessary edition in the assignment where necessary, moreover after completing the assignments the writer should proof read the whole draft and make necessary corrections where required and also should check for the grammatical mistakes if any. The writer should follow proper reference style as prescribed by the tutor. Following the above mentioned plan can help the writer make a quality assignment (Currie, 2005). Task 3 Write a 1000 word REFLECTIVE piece (with relevant academic references) that critically analyses the following FOR THIS SPECIFIC ASSIGNMENT: Critical Reflection Report: To begin with, the module study skills for postgraduate learning has been helpful in so many ways as it helped me develop my skills for the post graduate study level. During the course I learnt many things which enabled me to improve my study performance and enhance my skills both at studies and inter personal skills. Further devising a project plan strategy has helped me a lot in enhancing my skills as how a research is done, what are the necessary steps that should be considered, what the different ways through which data could be are collected and how data could be collected. However there were certain problems which were encountered during the research report such as data collection. It was not easy to gather a comprehensive and to the point data from the various resources, therefore the writer has to be very precise and accurate about selection of data as wrong data could lead to ambiguous statements and can distract the writer from main topic. Therefore from the current module I have learnt how to search for a particular topic and how to extract the relevant material from it. However, this practice will remain helpful through my academic career as I will need to search for other subjects as well in order to prepare the assignments (Kolb, 1999). Another aspect which has helped me during this module is the time management. Time management is an effective tool through which one can mange different activities on time and can give proper time for completing the task as well. During the current assignment, in order to complete and submit the assignment on time, I made a proper work break down structure through which I divided each task in small chunks and allotted time as per its priority and this helped me in managing the task in time. Moreover, the division of work according to an allotted time helped me expedite my activities and complete them on time. This particular aspect of time management will be greatly helpful for me in my future life as this practice will allow me to do the tasks in future in the same way. This will further help me to complete my tasks on time also making a break down structure and allotting time will reduce my work burden and I will be able to do the same the work in a more professional and proper manner rather than haphazardly (Allwood, 1980). The process of searching has enabled me to skim through the documents and take the relevant ones out rather studying each and every document and wasting my time. This is an important quality the researcher must posses as in case of short time and where quick action is required, this quality enables the reader to quickly skim through the important notes and respond accordingly (Lillian, 2005) During the course of this assignment as many articles and journals were gathered in order to retrieve useful information for the assignment, by going through this practice, my reading habit has enhanced a lot and reading more has also enhanced my knowledge about particular topic and in future same practice will increase my knowledge about different topics. Another important learning through this assignment is that the more I read different articles and books it enhances my vocabulary. Prior to getting into the reading habit, my vocabulary was week but now if I find I am not aware about any topic or I lack in any information then I search for the particular topic and learn about that topic. The reading habit has made books my friend and through this I enhance my knowledge about different subjects and topics. This habit can help me in future as well as whatever is learnt in present or past does help the individual in future as well and this can save the time of the individual in future from relearning (Martin and Harrell, 2004). Talking specifically of the SSPL assignment, it was a great learning over all. As the assignment itself was focusing primarily on the ways students gathers information in order to make an assignment. For a student it’s a great learning throughout his education career as this enables the student to learn the proper way of making the assignment. This in turn helps the student score good grades. From the current assignment, I came to know that the first thing after getting any assignment or project is to understand its instructions well before starting and after understanding the instructions, an initial plan or structure should be drafted that comprises of the writers ideas, and then information should be gathered accordingly. This drafted structure helped me to have symmetry in my work. However, during the collection of information I came up with better ideas and the information collected gave me new ideas to think in different perspectives about the same topic. Through this assignment I came to learn about making connection of the previous paragraph to the link, rather than jumping from one topic to another (Kim, 2001). Another important learning through this assignment which will benefit me in the future as well is the proper referencing of the information I took from other sources. This prevents me from plagiarism. As plagiarism is copying someone else work or ideas without giving any credit or reference (Burney, 2012). I learnt through this assignment that copy pasting any authors work is unethical, however, if one reproduce any idea in his/her own words by properly referencing it, then it is not plagiarism. However, through this practice I came to know about different styles of referencing such as APA style Harvard style of referencing. To put it in a nutshell, it was a great learning experience through this assignment and it will help me in future to draft quality assignments and score good grades. And it is accurately said by Oliver Wendell Holmes, Jr. that: â€Å"To be master of any branch of knowledge, you must master those which lie next to it; and thus to know anything you must know all†. ~Oliver Wendell Holmes, Jr. References: Allwood, J. (1976), Linguistic Communication as Action and Cooperation, Monographs in Linguistics 2, Dept of Linguistics, Goteborg University. Allwood, J. 1980), â€Å"Power and Communication† in Allwood, J Ljung, M (red): Alvar – A festshrift to Alvar Ellegard, SPELL 1, Dept of English, Stockholm University. Bain, A. (2000), â€Å"The school design model: strategy for design of 21st century schools†, in Dimmock, C. and Walker, A. (Eds), Future School Administration: Western and Asian Perspectives, Chinese University Press, Hong Kong, pp. 131-66. Bell, L. (2 002), â€Å"Strategic planning and school management: full of sound and fury, signifying nothing? † Journal of Educational Administration, Vol. 0 No. 5, pp. 407-24. Bell, L. and Chan, D. W. K. (2005), â€Å"Principals’ leadership and strategic planning in primary schools in Hong Kong and England: a comparison†, International Studies in Educational Administration, Vol. 33 No. 3, pp. 2-21. Burney, A. (2012), Plagiarism, [online], available at: http://www. uok. edu. pk/news/docs/PlagPres. pdf, accessed on 06/05/2012. Lillian. C, (2005), Intercultural Business Communication, 4th ed. Englewood Cliffs, NJ: Prentice-Hall. Currie D. , (2005) Developing and applying study skills. London: Chartered Institute of personnel and development. Covey S. R. , (2004) The 7 habits of highly effective people. United Kingdom: Simon Schuster UK ltd Dawson, C. (2002), Practical Research Methods, New Delhi, UBS Publishers’Distributors. Durfee, W. (2008), Project Planning and Gantt Charts, [Online], available at: http://www. me. umn. edu/courses/me2011/handouts/proj_planning. pdf, accessed on 05/05/2012. Kumar and Ranjit, 2005, Research Methodology-A Step-by-Step Guide for Beginners,(2nd. ed. ),Singapore, Pearson Education. Kim, Y. Y. 2001), Becoming intercultural: An integrative theory of communication and cross-cultural adaptation. Thousand Oaks, CA: Sage. Kolb D. (1999). The Kolb Learning Style Inventory, Version 3. Boston: Hay Group. Martin, J. N. , Harrell, T. (2004), Intercultural re-entry of students and professionals: Theory and practice. In D. Landis, J. M. Bennett, M. J. Bennett (Eds. ), Handbook of intercultural training, 3rd ed. 309–336. Thousand Oaks, CA: Sage. Saunders M. , Lewis P. and Thornhill A. , (2003) Research Methods for Business Students. 5th ed. England: Pearson Education Limited. How to cite Study Skills Assignment, Papers

What does globalization mean for Lafarge free essay sample

What does globalization mean for Lafarge and how can it globalize effectively? What role does the nature of industry play in the globalization process? Localization and globalization- those two aspects, according to Lafarge policy are the principals to growth In last decade Lafarge accelerated the pace of its growth into new countreis by acuaring companies and expending into new business and new products through its four divisons (cement, aggregates and concrete, roofing and gypsum). Through numerous acquisitions and joint ventures, Lafarge became a Global company and a leader in cement. In General globalization for Lafarge means entering the new markets and growing by acquisitions. The company uses its acquisitions as a bridgehead to introduce the group’s product such as, gypsum, aggregates, etc. with the aim to create a building materials didvison in each country. On the other hand in the building materials business, markets are local (consumer tastes diversive, business strategies of companies results in fragmentation of different markets, different trands and competitors depending form the country). We will write a custom essay sample on What does globalization mean for Lafarge or any similar topic specifically for you Do Not WasteYour Time HIRE WRITER Only 13.90 / page There are also two aspects- high transportation costs and low inventories- which anables to build sustainable, worldwild competitive advantage by locating in one country. 2. Should Lafarge grow by expanding current operations or should it grow by acquiring foreign firms? Why is growth imperative in this industry? Lafarge should do both. On the one hand should grow by acquiring foreign companies (as building a greenfiels pland is much more expensive than buying an existing one). By the acquisitions company can use its presence in the market as a bridgehead to introduce the group’s product other than cement and creat a leader in each country they enter. One of the main motive of th growth is to remain visible and attractive to investors, expanding cashflow. As a long term goal of the growth is achieve profitability for new operations 3. Is the overall business strategy of Lafarge in tandem with its principles of action and the Lafarge way? Althought Lafarge achieved its goal to become the nuber one company in the construction business, managing of growth itself still needs improovenent. A lotof improovemenst has to be made in the field of working across different cultures, languageandminset. The culture difference should also inflects the decision making process, which is not perfect in my opinion. Decisions are taken by the Direction Generale, even at the regional and coutry level. Managers exist to implement thedecisions of the DG. Also having The DG taking most of the decisions might not be a great strategy since every territory seems to vary.

Rural Values vs. Urban Idealism essays

Rural Values vs. Urban Idealism essays The 1920s was a time of great change for the American people, WW1 had just ended and Americans were trying their best to forget the horrors of war and live up the good times. Lifestyles were changing as new inventions like the automobile gave people the freedom to travel long distances whenever they pleased while various common household appliances like the washing machine and dishwasher were saving women valuable housework time that could now be spent working in jobs or on entertainment. Residential patterns were also undergoing a massive transformation. For the first time in American History the urban population of the nation outnumbered the rural as people flocked to the cities in record numbers to find employment. The yeomen farmer was no longer idolized as the American Dream and was rapidly becoming a thing of the past as more and more Americans found themselves trading in their hoes and plows for assembly line wrenches. Factories were the new place of employment for the average man, as growing ones own food became a thing of the past. The average American family was now living off of wages, renting their residence, and buying their food from the supermarket. Appliances and cars increasingly became necessities as consumerisms begin to dominate the economy. During this period of time a distinctive rift began to manifest itself between the people of small towns and those of the big cities. The morals and values of these different places slowly, but surely begin to drift apart leading to a fair amount of conflict. To begin with, rural people generally lived in small tight knit communities where everyone knew each other. In these communities everyone generally attended the same local Christian congregation and shared the same basic values and beliefs. Rural people clung tightly to their community values and were weary of outsiders, especially those who came from what they saw as morally corrupt big citie...

How to Create Amazing Content Upgrades for Your Blog - CoSchedule

How to Create Amazing Content Upgrades for Your Blog If you know anything about online marketing, you are aware of the power of email. After all, email has a 3800% ROI. Yes, email is that  powerful. But in order to use email to grow your business, you first need to have an email list. And to get one, you need to acquire subscribers. There are many tactics you can use to get more subscribers for your email list, but theres one that has been the darling of the online marketing world for the past few years. Im talking about content upgrades. If you dont know what they are, I will explain you everything you need to know about them. Lets get started. How to Create Amazing Content Upgrades for Your BlogWhat Content Upgrades Really Are A content upgrade is any kind of extra content that your blog's visitors can get access to in exchange for their email address. In a way, they resemble to lead magnets, in the sense you send them something for their email address. But what sets them apart is what makes content upgrades so effective. First of all, a content upgrade needs to be relevant  to the content piece that visitors are already consuming. Then, they need to add extra value  to the reader for free. Content upgrades need to add extra value to the readerFor example, the content upgrade you can find at the bottom of this article, a checklist with everything you will have learned, was made just for this article. On the contrary, if I had created a highly detailed and actionable yet unrelated lead magnet, it wouldn't have the same impact on you. You may not be as enticed to download it compared to the lead magnet because it may not be relevant to you. The key of a content upgrade, however, isn't just to let a visitor download something related to an article. In the case of this article, I could have offered you a resource list with related articles to this one. That could work because it's related to this article. But would it add extra value to you? Probably not. I could easily link to those articles and that would be it. What matters the most, and what makes people want to download content upgrades so much, is that they add a lot of extra value to the article, and most importantly, to the reader. Content upgrades are so hot right because for one reason: they work. Let me show you some examples of famous people that have used content upgrades to grow their businesses: Brian Dean from Backlinko  increased his conversion rate from 0.54%. to 4.82%. Clay Collins, co-founder of LeadPages, said that content upgrades  were the number one factor  in growing their email list. James Scherrer from Wishpond, found content upgrades convert  their visitors 575% better  compared to the articles that don't feature one. One company that uses content upgrades, not surprisingly, is , the company that hosts this same blog. I can't speak for their results, but I can imagine given the amazing job they are doing with their content marketing and promotion, and the relevancy of their offers, they must be doing great. For example, in one of their most recent articles, as soon as you start scrolling down they offer you a "template bundle" with information that is related and expands the idea of the article. I don't know about you, but downloading a bundle of templates sounds really good. This is how uses content upgrades, and they do it great. Now you know what they are and well they work, I will show you how you can create one to start getting these same results. Recommended Reading: 113 Content Types to Organize With Your Marketing Calendar How to Create Content Upgrades for Your Blog Step #1: Define the Problem Your Content Is Solving As you already know by now, content upgrades have to be relevant to your visitors' problems. As a consequence, before you create your content upgrades, you need to make sure you know what these problems are. You may think  you know, but you need to be 100% sure to be able to improve your conversion rate and make your visitors happy. In order to find your visitors' problems, you need to ask yourself a few questions that will help you dig deeper on the problem at hand: What is the content piece about? What is the audience? What problem is your content trying to solve? What are you trying to teach them? What can you  teach them? Let's take this article as an example. The answer to each question in the order they were asked would be: This article is about what content upgrades are and how to use them to get more email subscribers. The audience is made up of bloggers, content marketers, and marketing managers that are trying to grow their email list. Your problem is you want to grow your email but you can't or don't know. You may also want to grow it faster than you currently are. I'm trying to teach you how to grow your email list with a technique called content upgrades. I can teach you why they are so powerful because I have case studies to show, and also how to implement them because I have done it many times in the past. As you can see, all these questions put in evidence the problem this article is solving. This gives me a good idea of what you are trying to accomplish by reading this article, and how I can help you solving it. But most importantly, it gives me a better idea of how I can deliver extra value through the content upgrade. Creating content upgrades? Ask, "How can I deliver extra value?Step #2: Develop the Content Piece In this step, you only need to do what you normally would: you create your content. Since you already know the problem you are trying to solve, you only need to deliver that solution within your content piece. In the case of this article, it took me over 2k words to deliver all the value I could to help you solve your problem: growing your email list. Now, it's time to see how we can expand this value through the content upgrade. Step #3: Expand the Value You may know what problems your audience have, and you have already created the solution to that problem in the form of an article. Now it's time to expand on its value. First of all, remember there's a finite amount of problems you can solve for your audience, mainly because your audience is (and should be) finite as well. If you have ever created buyer personas for your blog, you know you need to target your content  towards a small group of people with a clear set of problems. With that said, you need to ask yourself, how will overdeliver  on your value? Just giving them a PDF without adding anything extra won't make much of a difference on your visitors' life. Always focus on adding more value, so it's a no-brainer for your visitors to download your content upgrade. The easiest way to expand on the value of your content piece is by taking the biggest lessons and insights, and make them better. There are plenty of ways you can do that: Expand on the insight Make it more actionable Make it easier to understand Show a step-by-step process of how you can implement it Show pictures of how it's done Show videos of how it's done Provide templates Provide transcriptions Provide a mind map with all the insights or concepts Create a graphic explaining them These ideas will help you provide the additional value your visitors are looking for, and what will make them want to download your content upgrade. Recommended Reading: The 6 Types of Social Media Content That Will Give You the Greatest Value Step #4: Define the Type of Content Upgrade Before we move on to the creation of the content upgrade, which is the one that most people focus on first, you need to define what kind of content upgrade you will create. Here's the thing, there are many types of content upgrades you can use. There's no right or wrong content upgrade per se, as it depends on your content piece, your style, and the value you are giving away. The most common ones are: Article in PDF Audio version Cheat sheet Checklist Resource list Templates Transcription Video Worksheets My favorite one is the checklist, as it takes a whole article, and condenses its value in a few pages. Not only that, but they are also action-focused. I've personally found they work better than the other ones as well. Still, you should try a few types and see which one works better for you. If you are still wondering what these different types of content upgrades look like, here there are some examples that will hopefully inspire you: Optin Monster Type: Cheat Sheat Article: 700+ Power Words That Will Boost Your Conversions Value: Get the each of the 700 words in one simple list, organized by type. Backlinko Type: Checklist Article: SEO Strategy Case Study (#1 Ranking 963% More Traffic) Value: Take a step-by-step look of the specific actions you need to implement to get more inbound links with guesto-graphics. Video Fruit Type: Video training Article: Expanded Guest Post: How to 100x the effectiveness of your next guest post Value: See a video screencast with Bryan Harris implementing the steps mentioned in the article to expand the value of the guest posts. Nerd Marketing Type: Audio transcription Article: Podcast 27: A â€Å"One-Two Punch† Email Campaign to Increase Order Frequency Value: If you can't listen to the podcast, or prefer to read and not listen (like I do), read a word-by-word transcription of the email campaign Drew Sanocki uses to increase order frequency. LeadPages Type: Worksheet Article: The Unique Content Process: How To Write What No One Has Ever Written Value: Find the most important insights of the unique content process explained in the article without having to sift back through the post later. Recommended Reading: How to Generate and Nurture Leads With Brittany Berger from Mention Step #5: Create Content Upgrade Now that you have everything in place, it's time to (finally!) create your content upgrade. Here's when you want to take some time to make sure you make your content upgrade as awesome as possible. After all, if you are giving away a lot of extra value, you can't do it while you are multitasking or in between calls. When creating your content upgrade, there are a few different roads you can take, from the best and most expensive to the cheapest (and probably worst quality). Hire a Designer This is probably the best way to go. Unless you are a designer yourself, you don't have the skills nor time to create a good-looking content upgrade. However, if you are going to hire a designer, make sure to get a good one. Remember that you always get what you pay for. If you have a designer in-house, then this is a no-brainer for you. But if you don't, it may end up being a bit expensive for you. Still, it may be worth the investment. If you are going to hire a designer, make sure to get a good one.Two companies that may help you create and design a high-quality content upgrade are Design Pickle  and Pug Shop Design. They offer design services for a flat free and at a good price. Use Beacon One tool that was created just to create content upgrades and lead magnets is called Beacon. It's probably one of the best-hidden marketing tools out there, so I highly recommend you take a look at it. It's a bit buggy, but it does its job at a good price. It has everything you need for any kind of content upgrade you want to create. They let you import your content, pick a template, customize it, and once you have it finished, you only need to click "Save" and "Export PDF" and you are done. If you end up downloading my content upgrade at the bottom of the article, you will see how their content upgrades look like. Use Canva Canva  is like Photoshop for amateurs (like me). You can make some pretty neat designs, and if you are creative enough, you may end up with a cool simple design. This is best for small checklists and the like, not for long or complex ones. Do It Yourself You can always fall into the common DIY trend and try to do something with Word, Pages, iBooks Author or Photoshop. Depending on your skills, this may be a good idea or not. If you are like me, it's probably not. I used iBooks Authorfor a while, and it worked pretty well. But they didn't look very professional, so I stopped using it once I started with Beacon. You can still use these tools for simple resource lists and PDF versions, not for checklists and worksheets, or any other more complex kind of content upgrade. Recommended Reading: How to Create an E-Book and Publish it on Amazon KDP Step #6: Create Landing Page If you remember what I said in the beginning, you give out content upgrades in exchange for someone else's email. But where do you make this exchange? It's not that your visitors will send you a postcard with their email address so you can add them to your list in 3 to 5 business days. That's a bit old-fashioned, don't you think? You need to do it in a convenient and seamless way. That's what landing pages are for. You create a page just for people to visit, put their email information, and download the content upgrade. My favorite tool to do this is by far LeadPages. You only need to pick a template, put the copy where it belongs, add your content upgrade, create a simple autoresponder email sequence, and publish it. This is how you do it: First, open an account with them. They don't have a free trial, rather they offer a 30-day money back guarantee. Either way, I highly recommend you spend the money on their tool, as it's one of the best and most fundamental pieces of any online marketing campaign. Once you have opened your account, you will be taken to My Page, which is kind of a dashboard for your account. Before creating the LeadPage, we need to add the content upgrade. To do that, click on your username on the right, and click "Lead Magnets". Click on "Create New Lead Magnet" button on the right. Then, give your lead magnet a name, upload it, choose a sender email and name. Finally, add a simple message that the recipients of the email will see when they get the content upgrade on their email account. Don't overcomplicate this, because you can change it later. Once you are done with this, go back to the LeadPages page and click on the "Create New Page" button. Then, pick any of the dozens of free templates they show you. Filter by "Opt In" and sort by "Highest Converting". Pick one of the first ones you see. For the sake of this example, I will use this article to create the landing page. As you can see below, I simply added the name of this article in the landing page's title, and nothing else. Before clicking the "Publish" button, we need to integrate the content upgrade. To do so, click the CTA button and then the little link icon that shows up below it. Then, click the "View/Edit" button as you can see below. Then, click once again the big CTA button, and when the "Edit Your Form" sidebar shows up to your left, click the "Follow-up" tab. In there, below the "Add a File", choose the content upgrade you previously uploaded. Then, click "Save Close Form". Then I clicked "Publish". Just remember people are already sold to your content upgrade, so you don't have to overcomplicate this. Look at my landing page below and you will see. It's uber-minimalistic. Just the name of the article, the download button, and nothing more. Just remember people are already sold to your content upgrade, so you don't have to overcomplicate this. Look at my landing page below and you will see. It's uber-minimalistic. Just the name of the article, the download button, and nothing more. Step #7: Promote Within Your Post Now it's time to put the content upgrade where it belongs: in your articles. You need to make sure people know there's something valuable waiting for them. Otherwise, they will most likely ignore it when they see it. You have a few options to do so. Create a Knowledge Gap This is something I learned from Bryan Harris. He recommends opening what he calls a "knowledge gap", like the one you found at the intro of this article, and then close it at the end, as you can see below. This creates a "gap" in the mind of your visitors that makes them want to scroll down and see what's the article about, and how they can get that extra value. Add Banners and Slide-Ins Another way is to add a static banner or a slide-in within your article so people "bump" into it as they read. This is what usually does, as I showed you before. Put It at the End (and Hope for the Best) This is what many people (or most?) do. They just put the content upgrade at the end with just a link, and hope people will find it. Apparently, these people think since they already took the time to create the content, they don't have the time to actually promote it correctly. Don't make this mistake. Make sure everyone finds and click on the link that leads to the content upgrade. Using the awesome Pareto Principle, 80% of your results will come from 20% of your time. This is your 20%, so make sure you use it right. Promote your content upgrade. Grow your list.

The EU should have remained a civilian power. Discuss Essay

The EU should have remained a civilian power. Discuss - Essay Example According to Stavridis, civilian power can be defined as an entity that has influence on international systems using economic, financial and political means in absence of any military means (Stavridis, 2001, p.3). Many wonder which type of power the EU exercises, whether civilian, military, or normative power, as they try to identify the roles of the EU in the international politics. This paper presents a very thoughtful discussion, specifically arguing for why the EU should have remained a civilian power. The first part of this paper focuses on the meaning of civilian power; the second part presents arguments explaining why the EU should remain a civilian power, then it lays out a counterargument detailing why EU should not remain civilian and at the end, it draws a conclusion of the discussion. The main considerations focus on the normative dimension of the EU’s foreign and security policy, its mandate as a trading power, and the EU as a substantial donor of humanitarian and development aid. Furthermore, the view of civilian power has been used to evaluate EU’s foreign policy based on its promotion of human rights, democracy as well as the rule of law, and its contribution in peacekeeping and stability efforts aimed at keeping the international system peaceful and stable. ... 13). Civilian power and military power are very different this is because civilian power unlike military power does not involve the use of armed forces, but mainly involves the use of economic, diplomatic and cultural policy instruments. In addition, peacekeeping strategies are also associated with civilian foreign policy, but military power is characterized by the use of military forces. A civilian power not only entails the means used by an actor but also the end to pursue it; therefore, being civilian power involves combination of four elements, which are means, ends, use of persuasion, and civilian control over foreign policy making (Smith, 2005, p.2). Moreover, one of the most prominent scholars of the civilian power concept, Francois Duchene did not clearly define it, but used two elements, which are means and ends to explain who can be termed as a civilian power (Smith, 2005, p. 3). Unlike a military power, which entails military means, military ends, hard power, and lack of d emocratic control, civilian power is actually the opposite. Therefore, when defining a civilian power, it is indispensable to consider all the four elements that include civilian means, civilian end, soft power, and democratic control (Smith, 2005, p.6). However, the use of military means can be associated with civilian power especially when they are used to protect human rights and democracy (Stavridis, 2001, p. 17). According to Sjursen, lack of military instruments is what defines a civilian power (Sjursen, 2006, p. 236). Furthermore, Hans Maull presented a clear definition of civilian power stating that civilian power refers to the recognition of the inevitability of

Write a Marketing Plan and Plan Report for a launch event of a new Essay

Write a Marketing Plan and Plan Report for a launch event of a new Master programme in Events Marketing Management, the only course of its kind in the world. Th - Essay Example The main purpose of this paper is to write a Marketing Plan and Plan Report for a launch event of a new Master programme in Events Marketing Management. The event shall take place on London Metropolitan University premises in June 2006. The underlying assumption is that there will be launch of the programme in June 2006, and the main goal of promotion marketing plan is to make positive public opinion and awareness towards Programme launch by this date. The London Metropolitan University needs to implement an integrated marketing plan to achieve a level of 100% enrolment at the Course during its first year, in order to do this it need to strategically categorise the potential students into various segmented areas. Consideration also needs to be given to the large number of students who have not decided on whether they want to join the Course. The plan advises what methods need to be used along will how they need to be implemented to obtain the overall objectives of the plan. The theoretical part or this paper will analyse the plan written in terms of academic marketing theory. Following are the key terms and concepts explained; they could be found over marketing plan in order of appearance. The main distinction of this marketing plan is in its core objective – promotion and marketing of new Master’s programme. Since it is not a tangible product or service, some characteristic points will be considered further. Context Analysis determines the overall strategic direction, it must be a â€Å"comprehensive and through analysis of the background situation†1, therefore consideration must be given to the market, customer, company (internal) and general environment (external) contexts. 2 These are specific ‘goals’ that need to be achieved during the timescale of the overall plan. It is important that these ‘goals’ are clearly understood and accepted by everybody involved. All of these

A Silent Mutation With Unknown Mechanism Biology Essay

A Silent Mutation With Unknown Mechanism Biology Essay A silent mutation with unknown mechanism of C1311T in exon 11 combined with IVS11 T93C (G6PD 1311/93) has been reported in G6PD deficient individuals in many populations. In our previous study, G6PD 1311/93 was identified as the common G6PD variant in one of the Malaysian aboriginal groups. Here, we report the screening for this variant via PCR-RFLP method and then direct sequencing of the entire 3 ´UTR of the G6PD gene in 175 aboriginal volunteers and 45 non-aboriginals. In the aboriginal group, 72 individuals (41%) carried the G6PD 1311/93 while 6 individuals (13%) were identified in the non-aboriginal set. Three novel SNPs, ss218178027 (+272 G/A), ss218178028 (+304 T/C) and ss218178024 (+357 A/G) were discovered in 3 ´UTR. SNP ss218178024, which is located inside an AG-rich region, has shown a significant association with G6PD 1311/93 as it was observed solely in individuals with G6PD 1311/93. Computational analyses indicated that three miRNAs have potential to bind to the reg ions encompassing ss218178024. Whilst transitions of A to G dose not destroy these miRNA target sites, it extensively alters the mRNA secondary structure and creates a putative hsa-miR-877* binding site. Notably, ss218178027 and ss218178028 do not change mRNA secondary structure. It could be speculated that ss218178024 have a potential functional effect on the down-regulation of mRNA and consequently G6PD deficiency either by affecting mRNA secondary structure or mirRNA regulation process. This is the first report of clinical association of a SNP in 3 ´UTR of G6PD mRNA. Genetic variations in the G6PD gene are responsible for G6PD deficiency in humans. More than 140 ethnic reliant nucleotide variations in the G6PD gene have been reported (Nkhoma et al 2009). Most of these variants are single missense mutations, with the rest being either double or triple missense mutations or small in frame deletions (Cappellini, G Fiorelli 2008). All these mutations alter the protein sequence of the G6PD enzyme by either amino acid substitution except for a silent mutation of C1311T in exon 11 combined with IVS11T93C (designated here as G6PD 1311/93). This genotype has been reported in G6PD deficient individuals in different ethnic populations with different frequency (Vulliamy et al. 1991; 2000; Jiang et al. 2006; Daoud et al. 2008; Jalloh et al. 2008; Wang et al. 2008; Moiz et al. 2009 ). This combination is a special G6PD variant where the carrier is deficient without any changes to the protein sequence of the G6PD enzyme. From previous studies, association of th ese two has been shown as significant in reducing G6PD enzyme activity in some individuals and hence has clinical implications (Yu et al 2004; Wang et al 2008; Jiang et al 2006). It is notable that some of the individuals with G6PD 1311/93 presented with normal G6PD activity (Jiang et al 2006). Bearing in mind, it is reasonable to postulate that other change(s) in the G6PD gene with potential linkage disequilibrium by this combination is responsible for the enzyme deficiency. Importance of 3 ´UTR of human genes in the post-transcriptional regulation has been supported by finding of functional SNPs in the 3 ´UTR of a number of genes (ref). In the other word, genetic variations in the 3 ´UTR of some genes are associated with variety of human disease ( ref ). Cis-acting elements in the 3 ´UTR of human genes are key players in controlling of mRNA stability, localization and level of translation (ref). Conversely, according to a recent systematic search, 106 conserved motifs located in the 3 ´UTR of human gene are associated with post-transcriptional regulation which half of them likely are miRNA binding sites (Xie et al 2005). MicroRNAs (miRNAs) are a class of genes encoding short RNAs, which are known to inhibit gene expression by binding to the 3 ´UTR of the target transcript. Notably, miRNAs are predicted to regulate about 30% of all human genes by targeting sequences in their 3 ´UTR (ref) . Noteworthy, several SNPs inside the miRNA gene and the miRNA binding sites have been identified recently (ref). The associations of these SNPs with some disease like Parkinson and some kind of cancer have been documented (Sethupathy 2008; Shen 2008). Given that, in the present study, we sought to determine if any SNP in the 3 ´UTR of G6PD gene in G6PD 1311/93 is involve in the regulation of mRNA processing. Subjects and Methods This study was approved by the University Kebangsaan Malaysia (UKM) hospitals ethics committee. All subjects gave their written informed consent. In our previous study, we attempted to identify the molecular basis of G6PD deficiency in 25 deficient individuals from one of the Malaysia aborigine group, namely, the Negrito (data in press). Our earlier results showed that G6PD 1311/93 is the commonest G6PD variant in Negrito. No other mutations were detected in the remaining exons or adjacent regions of the G6PD gene for subjects with G6PD 1311/93. In the present study, blood was collected from 175 consenting volunteers from four sub-ethnic groups of Negrito namely Kintak, Lanoh, Jahai, and Bateq. A series of 45 non-aboriginal volunteers were selected as the reference group. Genomic DNA was extracted by using the Salting Out method (ref). The oligonucleotides used as primers were either designed by online primer-BLAST program or obtained from published data (Kurdi-Haidar et al. 1990). The G6PD gene sequence was obtained from NCBI (reference sequence NC_000023.9). Sequence of each exon was obtained from ENSEMBL (Transcript ENST000 00393562). Then two regions of the G6PD gene (region ab and cd in figure 1) were amplified using the PCR technique to detect variation in nt 1311 in exon 11and nt 93 in intron 11. A proportion of the PCR product from regions ab (207 bp) and cd (317 bp) were digested with the appropriate restriction enzyme according to the manufacturers instructions (New England Biolabs) and then run on 3% agarose gels, stained with ethidium bromide, and photographed under UV light. Region ab was digested with BclI and region cd was digested with NlaIII. For all samples, PCR direct sequencing was performed for 3 ´ UTR of G6PD gene by using 2 sets primer of ef (320 bp) and gh (397 bp). Figure 1: Schematic map of part of G6PD gene (exon 10 to exon 13). The arrows point to the positions of each primer site. Oligonucleotides a: 5 AAGACGTCCAGGATGAGGTGATC 3 and b: 5 TGTTCTTCAACCCCG AGGAGT 3 are the primers used to detect 1311 C>T transition. Oligonucleotides c: 5 TGGCATCAGCAAGACACTCTCTC 3 and d: 5 CCCTTTCCTCACCTG CCATAAA3 are the primers used to detect IVS11 nt93 T>C. Oligonucleotides e: 5 GAGCCCTGG GCACCCACCTC 3 and f : 5 TCTGTTGGGCTGGAGTGA 3 were amplified part of 3UTR and oligonucleotides g (5TCACTCCAGCCCAACAGA3) and h (5 GGTCCTCAG GGAAGCAAA 3) were amplified the rest of 3UTR of G6PD gene for sequencing. Bioinformatic Tools We used two computational tools for each section to confirm our results. F-SNP (http://compbio.cs. queensu.ca/F-SNP/) (Lee Shatkay 2008) and FASTSNP (http://fastsnp.ibms.sinica.edu.tw) (Yuan et al. 2006) was used to find putative functional SNP in 3 ´UTR of G6PD gene. The RegRNA program (http://regrna.mbc.nctu.edu.tw/) (Huang et al. 2006) and MicroInspector (http://bioinfo. uni-plovdiv.bg/microinspector/) (Rusinov et al. 2005) was utilized to identify the miRNAs binding sites inside 3 ´UTR of G6PD gene. Secondary structures of the full-length of G6PD mRNA and as well, 3 ´UTR was predicted using GeneBee (http://www.genebee.msu.su/genebee.html) and mFold (http://mobyle.pasteur.fr/cgi-bin/portal.py) (Zuker et al. 1999). The program RNAhybrid (http://bibiserv. techfak.uni-bielefeld.de/cgi-bin/rnafold_submit) (Rehmsmeier et al. 2004) was implemented as a tool for finding the minimum free energy hybridisation of mRNA and miRNA. Results Genotyping DNA from 175 aboriginals and 45 non-aboriginals were screened for presence of G6PD 1311/93. In overall 72 aboriginal individuals (41%) and 6 non-aboriginal subjects (13%) carried this combination (table 1). Through direct sequencing of DNA fragments, three novel SNPs, of ss218178027 (+272 A/G), ss218178028 (+304 T/C) and ss218178024 (+357 A/G) was found (Figure 2). SNP ss218178027 was observed in 6 subjects in aboriginal group with G6PD 1311/93 (table 1) inside of an AG-rich region (AGAAGGAAGGAGGAGG). SNP ss218178028 was observed in 4 aboriginal individuals which 3 of them carried normal alleles in 1311 and 93. None of our non-aboriginal samples carried ss218178027 or ss218178028. SNP ss218178024 also surrounds by other 30 bp AG-rich sequence (gggagggagggacaag ggggaggaaagggg) and it was observed in all those G6PD deficient individuals who carried G6PD 1311/93. In the absence of G6PD 1311/93, ss218178024 was not found. Females who were heterozygote for the G6PD 1311/93 were also heter ozygote for ss218178024. Figure 2. Partial nucleotide sequence of normal, heterozygote and homozygote females respectively for forward strand of ss218178024 (a1, a2, a3), reverse strand of ss218178027 (b1, b2, b3) and reverse strand of ss218178028 (c1, c2,c3). Arrows show position of each SNP. Table 2 SNP Individuals with G6PD 1311/93 individuals normal for G6PD 1311/93 ss218178024 ss218178027 ss218178028 Aboriginal individual 72 105 72 6 4 Non-aboriginal individual 6 37 6 0 0 Bioinformatics Analysis Search for reported SNPs inside of 3 ´UTR of G6PD gene By using F-SNP and FASTSNP programs, we found six SNPs have been reported inside of 3 ´UTR of G6PD gene including SNP ref ID: rs1050831,  rs1050774, rs1050773, rs1050830, rs1063529, rs1050757.  The last one is actually same with ss218178024. All of these known SNPs were discovered via cDNA sequencing and to date no clinical associations have been reported for them. Prediction of putative miRNA binding sites and mRNA secondary structure The wild sequence of 3UTR of G6PD was submitted to regRNA and MicroInspector programs to detect putative miRNAs target sites. The mutant variant of ss218178024, ss218178027 and ss218178028 was also submitted to evaluate effect of each SNP on creating or destroying the miRNAs target sites. However, in silico analysis indicated that three miRNAs have potential to bind to the regions encompassing ss218178024A. Of note, SNP ss218178024 is located inside seed region of these miRNAs which are hsa-mir-204, hsa-mir-211 and has-mir-1249 (figure 3). Moreover, further computational analyses reveal that transition of A to G in SNP ss218178024 creates additional miRNA target site for has- miR-877* which also is located inside seed region. Neither ss218178027 nor ss218178028 is targeted by any miRNA. The RNAhybrid program (Rehmsmeier et al. 2004) was implemented as a tool for finding the minimum free energy (MFE) hybridisation of mRNA and each miRNA. Figure 3 The predicted binding site for hsa-mir-211(A), hsa-miR-1249 (B), hsa- mir-204 (C) and hsa-miR-877* (D) at 3 ´UTR of G6PD gene. Perfect Watson-Crick or wobble base pairings between the 5 ´ end of the miRNA and the 3à ¢Ã¢â€š ¬Ã‚ ² UTR target sites was observed. The minimum free energy (kcal/mol) of hybridization is shown in parentheses. Position of ss218178024G is indicated by arrows. Using the program mFold and Genebee, we determined the potential effect of the SNP sequence alterations on RNA folding. As shown in figure 4, ss218178024G is predicted to alter the secondary structure of G6PD mRNA. Also, the free energy of full length mRNA and as well 3UTR predicted to be affected by this substitution. The lower free energy in wild type indicates that mRNA might be more stable in wild type compare with the mutant. In the other word, it is suggesting that altered mRNA is capable to faster degradation. We also submitted the substituted nucleotide sequences of ss218178027A and ss218178028C to the GeenBee and mFold server. No change in the secondary structure of neither full length mRNA nor 3UTR was observed. It might be assuming that ss218178027A and ss218178028C do not probably modify mRNA processing. Consequently, secondary structure of 3 ´UTR of G6PD mRNA has been also checked for the accessibility of miRNA binding site. A stable base-paired duplex observe in the allele A (figure 4a2) and improper binding for allele G (figure 4b2) (arrows show position of changes). Then, it can be assume that miRNAs can be bind to the target site in mRNA due to the accessible site in the substitution of ss218178024G. Genotype Change in secondary structure Change in secondary of full length of mRNA structure of 3 ´UTR 1311T No ss218178024G Yes Yes 1311T+ ss218178024G Yes ss218178027A No No 1311T + ss218178027A No ss218178028T No No 1311T + ss218178028T No Figure 4 Predicted secondary structures of full length wild-type mRNA (A1) and 3 ´UTR (A2) compare with predicted secondary structures of full length mRNA relating to allele 1311T plus ss218178024G (B1) and 3UTR relating to ss218178024G (B2). The free energy (kcal/mol) of the full-length mRNA and 3UTR is shown in parentheses. Statistical Analysis Discussion A recent systematic study of G6PD deficiency indicated a global prevalence of 4.9% with varying frequencies among different ethnicities (Nkhoma et al. 2009). Although comprehensive studies have identified the molecular basis of G6PD deficiency worldwide, some pertinent questions remain to be addressed. For instance, several studies have reported deficient samples with unknown mutation(s) (Ara ´mbula et al. 2000; Nuchprayoon et al. 2008; Barisic 2005; Laosombat 2005; Pietropertosa 2001; Jiang et al. 2006). Additionally, the silent mutation genotype of C1311T in exon 11 combined with IVS11T93C (G6PD 1311/93) does not explain the phenotype of G6PD deficiency in their carriers. Since there are appears to be no clear linkages to known sequence mutations with these examples, factors extrinsic to the G6PD gene sequence information need to be investigated. These factors may include the roles played by mRNA processing, the untranslated regions (UTRs) and regulatory function by miRNAs. To th e best of our knowledge the importance of mRNA processing and regulation by miRNAs has not been extensively studies with regards to G6PD deficiency. The roles of the UTRs of the G6PD gene have also not received much attention. Our literature search revealed two reports which had evaluated the role of the 3 ´UTR of G6PD gene in their respective deficient population and these reports did not reveal any SNP in the 3 ´UTR for G6PD deficient individuals (Nguyen Thi Hue 2009; Karadsheh 2005). Our present study attempts to shed light on the possible role(s) of the 3UTR of mRNA in G6PD deficiency, especially in the case of G6PD 1311/93. The roles in disease phenotypes played by sequence polymorphisms of the 3 ´UTR have been reported (Lambert et al. 2003; Goto et al. 2001; Yang et al. 2007). Here, we present the possibility that the SNP ss218178024 which we have identified in an AG-rich region of the G6PD 3UTR may participate in mRNA processing and can therefore be correlated with G6PD deficiency. There is, however, accumulating evidence on importance of some elements in the 3UTR like AU-rich, C-rich, CU-rich and AG-rich elements relating to mRNA stability by affecting mRNA secondary structure (SS). For instance, functional SNPs were found to occur within AG-rich elements in some genes like Factor VII (Peyvandi et al. 2005), CYP2A6 gene (Wang et al. 2006), PTPN1 (Di Paola et al. 2002) and NPR1 (Knowles et al. 2003). Therefore, to gain further insights into the role of ss218178024 in G6PD deficiency, we have analyzed the SS of both full length mRNA and 3UTR. Significant alteration was predicted in the SS of full len gth mRNA when we submitted the combination of 1311T and ss218178024G. Whilst in the SS of 3UTR, we observed a possible standard Watson-Crick paired duplex in allele A whereas allele G has a reshuffling of the base pairings resulting in a differing SS prediction for the RNA sequence. The role of structure on RNA function is akin to that of protein. Interestingly, SS of the either full length of mRNA or 3UTR including two substitutions of 1311T and ss218178027A or 1311T and ss218178028C was same with the SS of wild mRNA. This data is good in agree with Chen et al. (2006) which reported that non-functional SNPs in a gene usually have same secondary structure, but the functional SNPs usually change the mRNA secondary structure. Consequently, the free energy is affected by base substitution at ss218178024. In thermo stability point of view, the lower free energy (- 661.6 kcal/mol) in the SS of wild mRNA might be result in a more stable mRNA than mRNA with 1311T and ss218178024G. On the o ther view, SS contributes to interaction of regulatory elements with their target sequence in mRNA. In general, when target sequence is part of a stable base-paired with the other sequence of mRNA, the capacity of regulatory elements like miRNA to get involved in translational regulation could be diminished. Similarly, Hew et al. (2000) have been reported that an AG-rich region in elastin mRNA in chicken may affect mRNA stability and they proposed that alteration in SS in this region can affect the accessibility of endogenous RNse to the mRNA. Therefore, we postulated that miRNA binding site likely is not accessible in the wild mRNA due to its SS. When ss218178024G result in different mRNA SS the miRNA can access the target site as perfect complimentary of seed region is a key to the miRNA regulation. Nevertheless, recent evidence has discovered the significant miRNA expression in erythrocytes which dramatically altered in Sickle cell Disease (ref). Thus, our hypothesis in miRNA reg ulation of G6PD mRNA is reasonable. While, SS is able to modify half life of mRNA, it is also capable to influence interaction of specific sequence of mRNA with regulatory proteins or miRNAs. . Site accessibility is thought to affect the activity of a miRNA binding site. If the secondary structure is such that a potential miRNA binding site is part of a stable base-paired duplex, these bonds will need to be broken before miRNA::mRNA interaction can take place, effectively decreasing the fraction of mRNA molecules of a particular gene which is regulated by a miRNA in question. This could be one of the reasons some of the computational-predicted binding sites are inactive. Here, we demonstrate that a A357G mutation may potentially change the 3 ´UTR secondary structure and create a binding site for hsa-miR-877* affects G6PD expression by either inhibiting mRNA translation or inducing mRNA degradation (Can you explain this bit to me again when we meet). However, we gave evidence for the relevance of the SNP rs3 in G6PD deficiency in G6PD 1311/93 and possible explanation is linkage disequilibrium between this SNP with combination of 1311/93 inside of G6PD gene that might be affect the mRNA translation or stability through miRNA function. In conclusion, to the best of our knowledge, this study reports for the first time an association of a 3 UTR variant of G6PD in a large populations of G6PD 13111/93. However, functional studies are necessary to test this hypothesis. MicroInspector (http://www.imbb.forth.gr/microinspector) (Rusinov et al. 2005) W696-W700 Nucleic Acids Research, 2005, Vol. 33, Web Server issue MicroInspector: a web tool for detection of miRNA binding sites in an RNA sequence Ventsislav Rusinov, Vesselin Baev, Ivan Nikiforov Minkov and Martin Tabler Typically, SNPs occurring in functional genomic regions such as protein coding or regulatory regions are more likely to cause functional distortion and, as such, more likely to underlie disease-causing variations. Current bioinformatics tools examine the functional effects of SNPs only with respect to a single biological function. Therefore, much time and effort is required from researchers to separately use multiple tools and interpret the (often conflicting) predictions. (F-SNP Lee at al) The variant ESR1_rs2747648 affects the miRNA-binding site of miR-453, miR-181(b/d) and miR-219. Due to in silico analysis using miRanda (http://www.microrna.org/microrna/home.do), the variant ESR1_rs2747648 does not significantly effect the binding capacity of miR-219 and miR-181(b/d). However, the binding capacity of miR- 453 is stronger when the C variant allele is present, enabling to bind the complementary G nucleotide of the miR-453 seed. In contrast, the T allele attenuates the binding of miR-453, which we hypothesize to lead to a reduced miRNA-mediated ESR1-repression, in consequence higher ESR1 protein levels and an increased breast cancer risk. Therefore, the breast cancer protective effect observed for the C allele is biologically reasonable. However, functional studies are necessary to test this hypothesis. Due to the fact that endogenous estrogen levels are high premenopausal and drop down post-menopausal, it is plausible that the risk effect of this variant can only be detected in premenopausal women. RNA secondary structure prediction was carried out using the Vienna RNA Package 1.7.2. on the web interface for online RNA folding on the Vienna RNA WebServers.42 The target mRNA prediction was carried out using The microRNA.org resource This is likely because miRNA-mRNA binding is mediated by the RISC complex, and upstream and downstream regions of miRNA binding site may interact with RISC, which mediates miRNA-mRNA binding (26). A polymorphism in the 829C site (SNP-829C3T) is located near the miRNA binding site. 2007 Mishra mirna SNP rs12720208 is located 166 bp downstream of the terminating codon of FGF20 and lies within a predicted binding site for microRNA (miRNA) miR-433. (A) The predicted binding site for miR-433 at 30 UTR of FGF20 gene. At rs12720208, allele C base paired with G in Watson-Crick mode (as shown with a solid line), whereas allele T wobble base paired with G (as shown with a dashed line). ØØ ² Ù†¦Ãƒâ„¢Ã¢â‚¬Å¡ÃƒËœÃƒâ„¢Ã¢â‚¬Å¾Ãƒâ„¢Ã¢â‚¬ ¡ geenbee 2009 capasso Although the mechanism by which interaction of proteins with the G3A sequence might affect message stability remains a matter of speculation, the fact that this sequence is located within a large region of stable secondary structure in the 39-UTR of the elastin mRNA (4) suggests the possibility that RNA/protein interactions at this site may alter the stability of this secondary structure, perhaps affecting the accessibility of endogenous RNases to the mRNA. However, detailed understanding of the mechanism of this process awaits further characterization of the nature of binding protein and the consequences of its interaction with the G3A motif in elastin mRNA. Acknowledgment-We acknowledge GA rich Hew From a physical point of view, we expect that the interaction of a miRNA with its target will depend on the state of the target region prior to interaction. In particular, if the target sequence is already bound (by Watson-Crick base-pairing) to another section of the mRNA chain, this will e_ectively pose a barrier to the base-pairing with the miRNA, and the capacity of such target sequences to mediate translational repression could be diminished. If we were able to predict the accessibility of a potential miRNA binding site, this might improve our target predictions. gi|109132849|AGGGACAGCCCAGAGGA CTGAGCCACCTCCTGCGCTCACTCCAGCCCAACAGAAGGAAGGAGGAGGG gi|108773792| CTGAGTCACCTCCTCCACTCACTCCAGCCCAACAGAAGGAAGGAGGAGGG gi|194680256| CTGAGCCCCCCCCCCCCCACCCCACCGCCCGG-AGCAAGGAAGAGGAGGG ***** * ** ** * * * * * **** ** * * * ******** gi|109132849|AGGGACAGCCCAGAGGA TGCCCATTCGTCTGTCCCAGAGCTTCTCGGTCACTGGGGCTCACTCCTGA gi|108773792| CGCCCATTCGTCTGTCCCAGAGCTTATTGGCCACTGGGTCTCACTCCTGA gi|194680256| CTATAGTTGGGGAAGACAGGGGCAAGGTCCTCAGAAGGCCGAGA ** * * * ** ** ** * ** gi|109132849|AGGGACAGCCCAGAGGA GTGGGGCCTGGGGCAGGAGGGAGGGACGAGGGGGAGGAAAGGGGCGAGCG gi|108773792| GTGGGGCC-AGGGTGGGAGGGAGGGACAAGGGGGAGGAAAGGGGCGAGCA gi|194680256| ATGGGCCCCCTGCACCCCCAGTCTCAGCGCCATTCCACATTCCTGGTC It would be anticipated that increased DHFR reduces MTX cytotoxicity in normal cells while conferring resistance in target cells. A comparison of the human and mouse DHFR 39-UTR sequences revealed that only 100 nucleotides downstream from the terminator codon were conserved between the two species (18). Numerous studies have focused on the effects of coding region variants on P-gp expression and function, whereas few noncoding region variants have been investigated. Mechanisms that alter mRNA levels can change mRNA expression and potentially G6PD activity. Recent evidence has demonstrated that the 3UTR of mRNA is an important regulatory site controlling interactions with mRNA degradation machinery (Hollams et al., 2002; Tourriere et al., 2002; Mangus et al., 2003; Wilkie et al., 2003). 3UTR RNA-binding proteins that recognize specific mRNA sequence elements and secondary structure dictate the fate of mRNA transcripts. Polymorphisms in the 3UTR of G6PD could disrupt RNA-protein interactions, resulting in altered mRNA stability. The stability of mRNA may be altered by 3UTR polymorphisms if recognition of specific mRNA sequence and secondary structure by regulatory proteins is disrupted (Shen et al., 1999; Hollams et al., 2002; Tourriere et al., 2002). A polymorphism in the 3UTR of human tumor necrosis factor-_ changes binding affinity for a multiprotein complex that contains the HuR regulatory protein (Di Marco et al., 2001). HuR binds AG-rich elements in the 3UTR of certain genes (Peng et al., 1998) and has been shown to stabilize mRNA containing tumor necrosis factor-_ 3_-UTR sequence motifs (Dean et al., 2001). There is one report that the 3435C_T synonymous variant decreases mRNA stability (Wang et al., 2005), but to our knowledge no pharmacogenetic research of this type has been conducted for ABCB1 3_-UTR variants. Thus, our mRNA half-life data represent novel findings as to the effects the _89A_T, _146G_A, and _193A_G polymorphisms have on ABCB1 mRNA stability and demonstrate the utility of using stable cell lines made with Flp-In technology for these measurements. Similarly