Saturday, January 25, 2020

A Silent Mutation With Unknown Mechanism Biology Essay

A Silent Mutation With Unknown Mechanism Biology Essay A silent mutation with unknown mechanism of C1311T in exon 11 combined with IVS11 T93C (G6PD 1311/93) has been reported in G6PD deficient individuals in many populations. In our previous study, G6PD 1311/93 was identified as the common G6PD variant in one of the Malaysian aboriginal groups. Here, we report the screening for this variant via PCR-RFLP method and then direct sequencing of the entire 3 ´UTR of the G6PD gene in 175 aboriginal volunteers and 45 non-aboriginals. In the aboriginal group, 72 individuals (41%) carried the G6PD 1311/93 while 6 individuals (13%) were identified in the non-aboriginal set. Three novel SNPs, ss218178027 (+272 G/A), ss218178028 (+304 T/C) and ss218178024 (+357 A/G) were discovered in 3 ´UTR. SNP ss218178024, which is located inside an AG-rich region, has shown a significant association with G6PD 1311/93 as it was observed solely in individuals with G6PD 1311/93. Computational analyses indicated that three miRNAs have potential to bind to the reg ions encompassing ss218178024. Whilst transitions of A to G dose not destroy these miRNA target sites, it extensively alters the mRNA secondary structure and creates a putative hsa-miR-877* binding site. Notably, ss218178027 and ss218178028 do not change mRNA secondary structure. It could be speculated that ss218178024 have a potential functional effect on the down-regulation of mRNA and consequently G6PD deficiency either by affecting mRNA secondary structure or mirRNA regulation process. This is the first report of clinical association of a SNP in 3 ´UTR of G6PD mRNA. Genetic variations in the G6PD gene are responsible for G6PD deficiency in humans. More than 140 ethnic reliant nucleotide variations in the G6PD gene have been reported (Nkhoma et al 2009). Most of these variants are single missense mutations, with the rest being either double or triple missense mutations or small in frame deletions (Cappellini, G Fiorelli 2008). All these mutations alter the protein sequence of the G6PD enzyme by either amino acid substitution except for a silent mutation of C1311T in exon 11 combined with IVS11T93C (designated here as G6PD 1311/93). This genotype has been reported in G6PD deficient individuals in different ethnic populations with different frequency (Vulliamy et al. 1991; 2000; Jiang et al. 2006; Daoud et al. 2008; Jalloh et al. 2008; Wang et al. 2008; Moiz et al. 2009 ). This combination is a special G6PD variant where the carrier is deficient without any changes to the protein sequence of the G6PD enzyme. From previous studies, association of th ese two has been shown as significant in reducing G6PD enzyme activity in some individuals and hence has clinical implications (Yu et al 2004; Wang et al 2008; Jiang et al 2006). It is notable that some of the individuals with G6PD 1311/93 presented with normal G6PD activity (Jiang et al 2006). Bearing in mind, it is reasonable to postulate that other change(s) in the G6PD gene with potential linkage disequilibrium by this combination is responsible for the enzyme deficiency. Importance of 3 ´UTR of human genes in the post-transcriptional regulation has been supported by finding of functional SNPs in the 3 ´UTR of a number of genes (ref). In the other word, genetic variations in the 3 ´UTR of some genes are associated with variety of human disease ( ref ). Cis-acting elements in the 3 ´UTR of human genes are key players in controlling of mRNA stability, localization and level of translation (ref). Conversely, according to a recent systematic search, 106 conserved motifs located in the 3 ´UTR of human gene are associated with post-transcriptional regulation which half of them likely are miRNA binding sites (Xie et al 2005). MicroRNAs (miRNAs) are a class of genes encoding short RNAs, which are known to inhibit gene expression by binding to the 3 ´UTR of the target transcript. Notably, miRNAs are predicted to regulate about 30% of all human genes by targeting sequences in their 3 ´UTR (ref) . Noteworthy, several SNPs inside the miRNA gene and the miRNA binding sites have been identified recently (ref). The associations of these SNPs with some disease like Parkinson and some kind of cancer have been documented (Sethupathy 2008; Shen 2008). Given that, in the present study, we sought to determine if any SNP in the 3 ´UTR of G6PD gene in G6PD 1311/93 is involve in the regulation of mRNA processing. Subjects and Methods This study was approved by the University Kebangsaan Malaysia (UKM) hospitals ethics committee. All subjects gave their written informed consent. In our previous study, we attempted to identify the molecular basis of G6PD deficiency in 25 deficient individuals from one of the Malaysia aborigine group, namely, the Negrito (data in press). Our earlier results showed that G6PD 1311/93 is the commonest G6PD variant in Negrito. No other mutations were detected in the remaining exons or adjacent regions of the G6PD gene for subjects with G6PD 1311/93. In the present study, blood was collected from 175 consenting volunteers from four sub-ethnic groups of Negrito namely Kintak, Lanoh, Jahai, and Bateq. A series of 45 non-aboriginal volunteers were selected as the reference group. Genomic DNA was extracted by using the Salting Out method (ref). The oligonucleotides used as primers were either designed by online primer-BLAST program or obtained from published data (Kurdi-Haidar et al. 1990). The G6PD gene sequence was obtained from NCBI (reference sequence NC_000023.9). Sequence of each exon was obtained from ENSEMBL (Transcript ENST000 00393562). Then two regions of the G6PD gene (region ab and cd in figure 1) were amplified using the PCR technique to detect variation in nt 1311 in exon 11and nt 93 in intron 11. A proportion of the PCR product from regions ab (207 bp) and cd (317 bp) were digested with the appropriate restriction enzyme according to the manufacturers instructions (New England Biolabs) and then run on 3% agarose gels, stained with ethidium bromide, and photographed under UV light. Region ab was digested with BclI and region cd was digested with NlaIII. For all samples, PCR direct sequencing was performed for 3 ´ UTR of G6PD gene by using 2 sets primer of ef (320 bp) and gh (397 bp). Figure 1: Schematic map of part of G6PD gene (exon 10 to exon 13). The arrows point to the positions of each primer site. Oligonucleotides a: 5 AAGACGTCCAGGATGAGGTGATC 3 and b: 5 TGTTCTTCAACCCCG AGGAGT 3 are the primers used to detect 1311 C>T transition. Oligonucleotides c: 5 TGGCATCAGCAAGACACTCTCTC 3 and d: 5 CCCTTTCCTCACCTG CCATAAA3 are the primers used to detect IVS11 nt93 T>C. Oligonucleotides e: 5 GAGCCCTGG GCACCCACCTC 3 and f : 5 TCTGTTGGGCTGGAGTGA 3 were amplified part of 3UTR and oligonucleotides g (5TCACTCCAGCCCAACAGA3) and h (5 GGTCCTCAG GGAAGCAAA 3) were amplified the rest of 3UTR of G6PD gene for sequencing. Bioinformatic Tools We used two computational tools for each section to confirm our results. F-SNP (http://compbio.cs. queensu.ca/F-SNP/) (Lee Shatkay 2008) and FASTSNP (http://fastsnp.ibms.sinica.edu.tw) (Yuan et al. 2006) was used to find putative functional SNP in 3 ´UTR of G6PD gene. The RegRNA program (http://regrna.mbc.nctu.edu.tw/) (Huang et al. 2006) and MicroInspector (http://bioinfo. uni-plovdiv.bg/microinspector/) (Rusinov et al. 2005) was utilized to identify the miRNAs binding sites inside 3 ´UTR of G6PD gene. Secondary structures of the full-length of G6PD mRNA and as well, 3 ´UTR was predicted using GeneBee (http://www.genebee.msu.su/genebee.html) and mFold (http://mobyle.pasteur.fr/cgi-bin/portal.py) (Zuker et al. 1999). The program RNAhybrid (http://bibiserv. techfak.uni-bielefeld.de/cgi-bin/rnafold_submit) (Rehmsmeier et al. 2004) was implemented as a tool for finding the minimum free energy hybridisation of mRNA and miRNA. Results Genotyping DNA from 175 aboriginals and 45 non-aboriginals were screened for presence of G6PD 1311/93. In overall 72 aboriginal individuals (41%) and 6 non-aboriginal subjects (13%) carried this combination (table 1). Through direct sequencing of DNA fragments, three novel SNPs, of ss218178027 (+272 A/G), ss218178028 (+304 T/C) and ss218178024 (+357 A/G) was found (Figure 2). SNP ss218178027 was observed in 6 subjects in aboriginal group with G6PD 1311/93 (table 1) inside of an AG-rich region (AGAAGGAAGGAGGAGG). SNP ss218178028 was observed in 4 aboriginal individuals which 3 of them carried normal alleles in 1311 and 93. None of our non-aboriginal samples carried ss218178027 or ss218178028. SNP ss218178024 also surrounds by other 30 bp AG-rich sequence (gggagggagggacaag ggggaggaaagggg) and it was observed in all those G6PD deficient individuals who carried G6PD 1311/93. In the absence of G6PD 1311/93, ss218178024 was not found. Females who were heterozygote for the G6PD 1311/93 were also heter ozygote for ss218178024. Figure 2. Partial nucleotide sequence of normal, heterozygote and homozygote females respectively for forward strand of ss218178024 (a1, a2, a3), reverse strand of ss218178027 (b1, b2, b3) and reverse strand of ss218178028 (c1, c2,c3). Arrows show position of each SNP. Table 2 SNP Individuals with G6PD 1311/93 individuals normal for G6PD 1311/93 ss218178024 ss218178027 ss218178028 Aboriginal individual 72 105 72 6 4 Non-aboriginal individual 6 37 6 0 0 Bioinformatics Analysis Search for reported SNPs inside of 3 ´UTR of G6PD gene By using F-SNP and FASTSNP programs, we found six SNPs have been reported inside of 3 ´UTR of G6PD gene including SNP ref ID: rs1050831,  rs1050774, rs1050773, rs1050830, rs1063529, rs1050757.  The last one is actually same with ss218178024. All of these known SNPs were discovered via cDNA sequencing and to date no clinical associations have been reported for them. Prediction of putative miRNA binding sites and mRNA secondary structure The wild sequence of 3UTR of G6PD was submitted to regRNA and MicroInspector programs to detect putative miRNAs target sites. The mutant variant of ss218178024, ss218178027 and ss218178028 was also submitted to evaluate effect of each SNP on creating or destroying the miRNAs target sites. However, in silico analysis indicated that three miRNAs have potential to bind to the regions encompassing ss218178024A. Of note, SNP ss218178024 is located inside seed region of these miRNAs which are hsa-mir-204, hsa-mir-211 and has-mir-1249 (figure 3). Moreover, further computational analyses reveal that transition of A to G in SNP ss218178024 creates additional miRNA target site for has- miR-877* which also is located inside seed region. Neither ss218178027 nor ss218178028 is targeted by any miRNA. The RNAhybrid program (Rehmsmeier et al. 2004) was implemented as a tool for finding the minimum free energy (MFE) hybridisation of mRNA and each miRNA. Figure 3 The predicted binding site for hsa-mir-211(A), hsa-miR-1249 (B), hsa- mir-204 (C) and hsa-miR-877* (D) at 3 ´UTR of G6PD gene. Perfect Watson-Crick or wobble base pairings between the 5 ´ end of the miRNA and the 3à ¢Ã¢â€š ¬Ã‚ ² UTR target sites was observed. The minimum free energy (kcal/mol) of hybridization is shown in parentheses. Position of ss218178024G is indicated by arrows. Using the program mFold and Genebee, we determined the potential effect of the SNP sequence alterations on RNA folding. As shown in figure 4, ss218178024G is predicted to alter the secondary structure of G6PD mRNA. Also, the free energy of full length mRNA and as well 3UTR predicted to be affected by this substitution. The lower free energy in wild type indicates that mRNA might be more stable in wild type compare with the mutant. In the other word, it is suggesting that altered mRNA is capable to faster degradation. We also submitted the substituted nucleotide sequences of ss218178027A and ss218178028C to the GeenBee and mFold server. No change in the secondary structure of neither full length mRNA nor 3UTR was observed. It might be assuming that ss218178027A and ss218178028C do not probably modify mRNA processing. Consequently, secondary structure of 3 ´UTR of G6PD mRNA has been also checked for the accessibility of miRNA binding site. A stable base-paired duplex observe in the allele A (figure 4a2) and improper binding for allele G (figure 4b2) (arrows show position of changes). Then, it can be assume that miRNAs can be bind to the target site in mRNA due to the accessible site in the substitution of ss218178024G. Genotype Change in secondary structure Change in secondary of full length of mRNA structure of 3 ´UTR 1311T No ss218178024G Yes Yes 1311T+ ss218178024G Yes ss218178027A No No 1311T + ss218178027A No ss218178028T No No 1311T + ss218178028T No Figure 4 Predicted secondary structures of full length wild-type mRNA (A1) and 3 ´UTR (A2) compare with predicted secondary structures of full length mRNA relating to allele 1311T plus ss218178024G (B1) and 3UTR relating to ss218178024G (B2). The free energy (kcal/mol) of the full-length mRNA and 3UTR is shown in parentheses. Statistical Analysis Discussion A recent systematic study of G6PD deficiency indicated a global prevalence of 4.9% with varying frequencies among different ethnicities (Nkhoma et al. 2009). Although comprehensive studies have identified the molecular basis of G6PD deficiency worldwide, some pertinent questions remain to be addressed. For instance, several studies have reported deficient samples with unknown mutation(s) (Ara ´mbula et al. 2000; Nuchprayoon et al. 2008; Barisic 2005; Laosombat 2005; Pietropertosa 2001; Jiang et al. 2006). Additionally, the silent mutation genotype of C1311T in exon 11 combined with IVS11T93C (G6PD 1311/93) does not explain the phenotype of G6PD deficiency in their carriers. Since there are appears to be no clear linkages to known sequence mutations with these examples, factors extrinsic to the G6PD gene sequence information need to be investigated. These factors may include the roles played by mRNA processing, the untranslated regions (UTRs) and regulatory function by miRNAs. To th e best of our knowledge the importance of mRNA processing and regulation by miRNAs has not been extensively studies with regards to G6PD deficiency. The roles of the UTRs of the G6PD gene have also not received much attention. Our literature search revealed two reports which had evaluated the role of the 3 ´UTR of G6PD gene in their respective deficient population and these reports did not reveal any SNP in the 3 ´UTR for G6PD deficient individuals (Nguyen Thi Hue 2009; Karadsheh 2005). Our present study attempts to shed light on the possible role(s) of the 3UTR of mRNA in G6PD deficiency, especially in the case of G6PD 1311/93. The roles in disease phenotypes played by sequence polymorphisms of the 3 ´UTR have been reported (Lambert et al. 2003; Goto et al. 2001; Yang et al. 2007). Here, we present the possibility that the SNP ss218178024 which we have identified in an AG-rich region of the G6PD 3UTR may participate in mRNA processing and can therefore be correlated with G6PD deficiency. There is, however, accumulating evidence on importance of some elements in the 3UTR like AU-rich, C-rich, CU-rich and AG-rich elements relating to mRNA stability by affecting mRNA secondary structure (SS). For instance, functional SNPs were found to occur within AG-rich elements in some genes like Factor VII (Peyvandi et al. 2005), CYP2A6 gene (Wang et al. 2006), PTPN1 (Di Paola et al. 2002) and NPR1 (Knowles et al. 2003). Therefore, to gain further insights into the role of ss218178024 in G6PD deficiency, we have analyzed the SS of both full length mRNA and 3UTR. Significant alteration was predicted in the SS of full len gth mRNA when we submitted the combination of 1311T and ss218178024G. Whilst in the SS of 3UTR, we observed a possible standard Watson-Crick paired duplex in allele A whereas allele G has a reshuffling of the base pairings resulting in a differing SS prediction for the RNA sequence. The role of structure on RNA function is akin to that of protein. Interestingly, SS of the either full length of mRNA or 3UTR including two substitutions of 1311T and ss218178027A or 1311T and ss218178028C was same with the SS of wild mRNA. This data is good in agree with Chen et al. (2006) which reported that non-functional SNPs in a gene usually have same secondary structure, but the functional SNPs usually change the mRNA secondary structure. Consequently, the free energy is affected by base substitution at ss218178024. In thermo stability point of view, the lower free energy (- 661.6 kcal/mol) in the SS of wild mRNA might be result in a more stable mRNA than mRNA with 1311T and ss218178024G. On the o ther view, SS contributes to interaction of regulatory elements with their target sequence in mRNA. In general, when target sequence is part of a stable base-paired with the other sequence of mRNA, the capacity of regulatory elements like miRNA to get involved in translational regulation could be diminished. Similarly, Hew et al. (2000) have been reported that an AG-rich region in elastin mRNA in chicken may affect mRNA stability and they proposed that alteration in SS in this region can affect the accessibility of endogenous RNse to the mRNA. Therefore, we postulated that miRNA binding site likely is not accessible in the wild mRNA due to its SS. When ss218178024G result in different mRNA SS the miRNA can access the target site as perfect complimentary of seed region is a key to the miRNA regulation. Nevertheless, recent evidence has discovered the significant miRNA expression in erythrocytes which dramatically altered in Sickle cell Disease (ref). Thus, our hypothesis in miRNA reg ulation of G6PD mRNA is reasonable. While, SS is able to modify half life of mRNA, it is also capable to influence interaction of specific sequence of mRNA with regulatory proteins or miRNAs. . Site accessibility is thought to affect the activity of a miRNA binding site. If the secondary structure is such that a potential miRNA binding site is part of a stable base-paired duplex, these bonds will need to be broken before miRNA::mRNA interaction can take place, effectively decreasing the fraction of mRNA molecules of a particular gene which is regulated by a miRNA in question. This could be one of the reasons some of the computational-predicted binding sites are inactive. Here, we demonstrate that a A357G mutation may potentially change the 3 ´UTR secondary structure and create a binding site for hsa-miR-877* affects G6PD expression by either inhibiting mRNA translation or inducing mRNA degradation (Can you explain this bit to me again when we meet). However, we gave evidence for the relevance of the SNP rs3 in G6PD deficiency in G6PD 1311/93 and possible explanation is linkage disequilibrium between this SNP with combination of 1311/93 inside of G6PD gene that might be affect the mRNA translation or stability through miRNA function. In conclusion, to the best of our knowledge, this study reports for the first time an association of a 3 UTR variant of G6PD in a large populations of G6PD 13111/93. However, functional studies are necessary to test this hypothesis. MicroInspector (http://www.imbb.forth.gr/microinspector) (Rusinov et al. 2005) W696-W700 Nucleic Acids Research, 2005, Vol. 33, Web Server issue MicroInspector: a web tool for detection of miRNA binding sites in an RNA sequence Ventsislav Rusinov, Vesselin Baev, Ivan Nikiforov Minkov and Martin Tabler Typically, SNPs occurring in functional genomic regions such as protein coding or regulatory regions are more likely to cause functional distortion and, as such, more likely to underlie disease-causing variations. Current bioinformatics tools examine the functional effects of SNPs only with respect to a single biological function. Therefore, much time and effort is required from researchers to separately use multiple tools and interpret the (often conflicting) predictions. (F-SNP Lee at al) The variant ESR1_rs2747648 affects the miRNA-binding site of miR-453, miR-181(b/d) and miR-219. Due to in silico analysis using miRanda (http://www.microrna.org/microrna/home.do), the variant ESR1_rs2747648 does not significantly effect the binding capacity of miR-219 and miR-181(b/d). However, the binding capacity of miR- 453 is stronger when the C variant allele is present, enabling to bind the complementary G nucleotide of the miR-453 seed. In contrast, the T allele attenuates the binding of miR-453, which we hypothesize to lead to a reduced miRNA-mediated ESR1-repression, in consequence higher ESR1 protein levels and an increased breast cancer risk. Therefore, the breast cancer protective effect observed for the C allele is biologically reasonable. However, functional studies are necessary to test this hypothesis. Due to the fact that endogenous estrogen levels are high premenopausal and drop down post-menopausal, it is plausible that the risk effect of this variant can only be detected in premenopausal women. RNA secondary structure prediction was carried out using the Vienna RNA Package 1.7.2. on the web interface for online RNA folding on the Vienna RNA WebServers.42 The target mRNA prediction was carried out using The microRNA.org resource This is likely because miRNA-mRNA binding is mediated by the RISC complex, and upstream and downstream regions of miRNA binding site may interact with RISC, which mediates miRNA-mRNA binding (26). A polymorphism in the 829C site (SNP-829C3T) is located near the miRNA binding site. 2007 Mishra mirna SNP rs12720208 is located 166 bp downstream of the terminating codon of FGF20 and lies within a predicted binding site for microRNA (miRNA) miR-433. (A) The predicted binding site for miR-433 at 30 UTR of FGF20 gene. At rs12720208, allele C base paired with G in Watson-Crick mode (as shown with a solid line), whereas allele T wobble base paired with G (as shown with a dashed line). ØØÂ ² Ù†¦Ãƒâ„¢Ã¢â‚¬Å¡ÃƒËœÃƒâ„¢Ã¢â‚¬Å¾Ãƒâ„¢Ã¢â‚¬ ¡ geenbee 2009 capasso Although the mechanism by which interaction of proteins with the G3A sequence might affect message stability remains a matter of speculation, the fact that this sequence is located within a large region of stable secondary structure in the 39-UTR of the elastin mRNA (4) suggests the possibility that RNA/protein interactions at this site may alter the stability of this secondary structure, perhaps affecting the accessibility of endogenous RNases to the mRNA. However, detailed understanding of the mechanism of this process awaits further characterization of the nature of binding protein and the consequences of its interaction with the G3A motif in elastin mRNA. Acknowledgment-We acknowledge GA rich Hew From a physical point of view, we expect that the interaction of a miRNA with its target will depend on the state of the target region prior to interaction. In particular, if the target sequence is already bound (by Watson-Crick base-pairing) to another section of the mRNA chain, this will e_ectively pose a barrier to the base-pairing with the miRNA, and the capacity of such target sequences to mediate translational repression could be diminished. If we were able to predict the accessibility of a potential miRNA binding site, this might improve our target predictions. gi|109132849|AGGGACAGCCCAGAGGA CTGAGCCACCTCCTGCGCTCACTCCAGCCCAACAGAAGGAAGGAGGAGGG gi|108773792| CTGAGTCACCTCCTCCACTCACTCCAGCCCAACAGAAGGAAGGAGGAGGG gi|194680256| CTGAGCCCCCCCCCCCCCACCCCACCGCCCGG-AGCAAGGAAGAGGAGGG ***** * ** ** * * * * * **** ** * * * ******** gi|109132849|AGGGACAGCCCAGAGGA TGCCCATTCGTCTGTCCCAGAGCTTCTCGGTCACTGGGGCTCACTCCTGA gi|108773792| CGCCCATTCGTCTGTCCCAGAGCTTATTGGCCACTGGGTCTCACTCCTGA gi|194680256| CTATAGTTGGGGAAGACAGGGGCAAGGTCCTCAGAAGGCCGAGA ** * * * ** ** ** * ** gi|109132849|AGGGACAGCCCAGAGGA GTGGGGCCTGGGGCAGGAGGGAGGGACGAGGGGGAGGAAAGGGGCGAGCG gi|108773792| GTGGGGCC-AGGGTGGGAGGGAGGGACAAGGGGGAGGAAAGGGGCGAGCA gi|194680256| ATGGGCCCCCTGCACCCCCAGTCTCAGCGCCATTCCACATTCCTGGTC It would be anticipated that increased DHFR reduces MTX cytotoxicity in normal cells while conferring resistance in target cells. A comparison of the human and mouse DHFR 39-UTR sequences revealed that only 100 nucleotides downstream from the terminator codon were conserved between the two species (18). Numerous studies have focused on the effects of coding region variants on P-gp expression and function, whereas few noncoding region variants have been investigated. Mechanisms that alter mRNA levels can change mRNA expression and potentially G6PD activity. Recent evidence has demonstrated that the 3UTR of mRNA is an important regulatory site controlling interactions with mRNA degradation machinery (Hollams et al., 2002; Tourriere et al., 2002; Mangus et al., 2003; Wilkie et al., 2003). 3UTR RNA-binding proteins that recognize specific mRNA sequence elements and secondary structure dictate the fate of mRNA transcripts. Polymorphisms in the 3UTR of G6PD could disrupt RNA-protein interactions, resulting in altered mRNA stability. The stability of mRNA may be altered by 3UTR polymorphisms if recognition of specific mRNA sequence and secondary structure by regulatory proteins is disrupted (Shen et al., 1999; Hollams et al., 2002; Tourriere et al., 2002). A polymorphism in the 3UTR of human tumor necrosis factor-_ changes binding affinity for a multiprotein complex that contains the HuR regulatory protein (Di Marco et al., 2001). HuR binds AG-rich elements in the 3UTR of certain genes (Peng et al., 1998) and has been shown to stabilize mRNA containing tumor necrosis factor-_ 3_-UTR sequence motifs (Dean et al., 2001). There is one report that the 3435C_T synonymous variant decreases mRNA stability (Wang et al., 2005), but to our knowledge no pharmacogenetic research of this type has been conducted for ABCB1 3_-UTR variants. Thus, our mRNA half-life data represent novel findings as to the effects the _89A_T, _146G_A, and _193A_G polymorphisms have on ABCB1 mRNA stability and demonstrate the utility of using stable cell lines made with Flp-In technology for these measurements. Similarly

Friday, January 17, 2020

The Ohio Gang

Hilary Barrett April 13, 2009 Ohio History Dr. Patrick Thieving Their Way into History In 1919 World War I had come to an end. Ten years later the stock market crashed throwing the United States into a Great Depression. The time period in between was a time that was classified by a boom in the economy and prohibition legalized by the eighteenth amendment. This amendment had lead to an increase of organized crime nationwide. In that time span of these two prominent moments in American history was one of the most scandalous presidencies in American history. It came from no other than Ohioan Warren G.Harding. Harding can be considered one of the worst presidents of all time. He won the Presidential election of 1920 which made him officially the President in January of 1921. Once he became president, he immediately made up his cabinet. Three members of his cabinet included his attorney general Harry Daugherty, his secretary of the navy Edwin Denby, and his secretary of the interior Alber t Fall. These three men along with Charles Forbes, Thomas Miller and Jess Smith were coined ‘The Ohio Gang’. ‘The Ohio Gang’ was a group of men either in Harding’s cabinet or they directly knew Harding.Although some of the members are not from Ohio, they were coined this name due to their relation to Harding. In fact a majority of the members were not from Ohio. Harding let these men do as they pleased. These men single handily put together some of the biggest scams of the 1920’s. The scandals they pulled off were neither elaborate or spectacular but they made a ton of money off of them. Daugherty was Harding’s first appointed cabinet member. The beginnings of ‘The Ohio Gang’ surfaced while Daugherty was in office. He was accused of selling his vote for five thousand dollars.From that point on any kind of scandal relating to Daugherty and had an affiliation with President Harding went simultaneously with ‘The Ohio Gan g’. In a nutshell, as soon as Daugherty was appointed by Harding, the gang began their scandals. Not only that, Daugherty was the single backing of all of the scandals that occurred during Harding’s presidency. For all tense and purposes Daugherty was the backbone of ‘The Ohio Gang’. The Department of Justice at the time had two desks with the names Jess Smith and Howard Mannington on them. Jess Smith was a long time friend of Daugherty. Daugherty and his brother actually set Smith up in business.Mannington was a long time political companion of Smith. They had both worked in Columbus together. Both Smith and Mannington were brought to Washington to help the attorney general. Mannington was released from his office though. Harding believed that Mannington was becoming too reckless for his administration and sent him to Cuba. He had slight affiliations with the gang but never really lived them out the affilations as much as the other members did. He went th ere on behalf of the largest banking company in the United States and was then no longer officially associated with ‘The Ohio Gang’.The 1920’s was a time of prohibition and having someone who was considered an alcoholic as a President only lead to scandal. The only part of ‘The Ohio Gang’ that related to Mannington was the embezzlement of alcohol to New York. John Gorini, Bill Orr, and Mannington would illegally sell permits. The money for these permits was given to Gorini, then to Orr, then to Mannington. Then if you would actually want to buy liquor you could at an extra cost. Every member of the chain of sales got a little kickback. Gorini alone made over two hundred thousand dollars in a matter of four months.Orr and Mannington also got cuts that big and sometimes bigger. Also, Manningtons right hand man, Jess Smith, also got a cut. The rest of the money made on the selling of alcohol and permits was not known by Gorini where it ended up. This wa s the only relation that Mannington had to the gang. Since he was gone before anything major had happened, he was the only one who got away without repercussion. He became rich and went on to have a very successful life. ‘The Ohio Gang’ even went and had their scandals go international. A Japanese man had a connection with Mitsui and Company.The bankers of this company handed one hundred one thousand dollar bills to the Japanese man. He in turn gave the bills to Gaston B. Means. Means originally worked for the Bureau of Investigation in Ohio. Means then handed over all of the money to Jess Smith. That was a grand total of 100,000 dollars made with just this one company. Harry Daugherty never seemed to be out of the action in all of the scandals that ‘The Ohio Gang’ was a part of. It started with alien property custodian Thomas Miller. He had accepted bribes by Smith to illegally transfer a German-owned American subsidiary to the American firm.John King also had a part in this scandal. He manipulated the alien property custodian’s office to his own benefit. He died right after he was indicted for this case. It was found that he left his widow fifty thousand dollars in American Metals bonds. Daugherty is connected because all three of these men were indicted for this case. It was the case that eventually leads to the demise of the head of ‘The Ohio Gang’. The biggest scandal that ‘The Ohio Gang’ pulled off was the Teapot Dome Scandal. The Teapot Dome is an area of oil bearing land in Wyoming and Elks Hills in California.The land had been set aside for the Navy in order to provide them with petroleum. Edwin Denby was the Navy Secretary at the time. He had almost complete control of what happened to this area. Albert Fall, who was the secretary of interior, was illegally leasing the land to two oil companies; the Mammoth Oil Company and the pan American Petroleum Company. In return, Fall would receive pers onal loans or gifts from the two different oil companies. Once the scandal came to a close, Fall had made over four hundred thousand dollars in loans or gifts.Fall resigned his position once authorities found out what exactly was going on in Wyoming and California. During the U. S. investigation, Denby was called to the stand. Since he was the one who was supposed to be watching the area one would think that he would have known exactly what was going on. Yet, he was another pawn of Daugherty and came to the stand and basically pleaded the fifth. It was clear that during his confession that he was too stupid to be crooked like the rest and just went along with what Daugherty or Harding wanted him to do.Due to the way he acted during the interrogation, he is known as Harding’s best employee since he did not confess to anything. During the Senate hearing, it came to the court that Fall used the money to pay off ten years of backed taxes. Two people also came to the stand and adm itted that they had leased land from Fall. They were Harry Sinclair and Edward Dohney. They both admitted to giving Fall large loans in order to lease off the land. Fall pleaded the fifth on these two accusations. Fall was found guilty on accepting money for oil leases. He was fined one hundred thousand dollars and sent to a year in jail.All of the oilfields were returned to the U. S. Navy. Charles Forbes was appointed by President Harding as the director of the Bureau of Veteran’s affairs. It was created by President Harding in order to help out veterans of World War One and future veterans of other possible wars. It has been since renamed and still holds some status today. Forbes did serve in WWI in the marines and had a reputation as being a deserter. Once Forbes received his rank from Harding, he immediately gave himself the honor of being a colonel in the United States Army.Also, the biggest scandal of the Bureau of Veteran’s affairs was that Forbes embezzled two hundred and fifty million dollars. This money was collected to help out various veterans and Forbes kept it for himself and the gang. As quickly as ‘The Ohio Gang’ came to power, they fell just as hard. Harding died on August 2, 1923. It has been said that he died from pneumonia yet it also could have been a heart attack. With this Calvin Coolidge came into office since he was Harding’s Vice-President. Once Coolidge took the oath of the oval office, ‘The Ohio Gang’ and their dominance in scandalous political events was over.The gang had put most of their funds that they received in a bank that Daugherty’s son burned to the ground. All of the embezzled money was mostly now gone. A perfectly good reason for this was so the authorities would not see the bank books of the gang. This way they could not arrest them on charges of tax invasion as well as the ones that they were facing already. Another place that the money ended up was in Means backyar d. Means had back gate that was opened with a special key. It was in some ways almost as good as a bank vault. It was camouflaged with vines so the average person would not see it.It was a small steel box that was lowered into the ground by a strong rope. Means kept the money that Smith had bought to him. He always kept a detailed account on how much money was coming in and how much was going out. At times, Means had as little as fifty thousand dollars and as much as five hundred thousand dollars in his backyard. Smith would usually make withdrawals and go right to Daugherty’s house. Jess Smith always had a key role in the gangs constant thieving. Smith was Daugherty’s right hand man. He helped Daugherty get much of his money. Smith had brought a revolver in Columbus the night before he committed suicide.Daugherty was with Smith the night he had bought the gun. Daugherty had gone to sleep and was awakened to Smith rolling around with a revolver in his hand. Smith was n ot dead yet, but he was on the point of going crazy and shooting himself. The next night he had been rooming with a friend of Daugherty. This person was awakened by a crash and saw Smith with his head in a waste basket and a revolver in his right hand. One of the main members was now dead and Daugherty was coming up on indictment. Not much is known why Smith killed himself but much can be assumed. The main theory is that Smith knew way too much.If Daugherty and Harding were the master minds, Smith was their associate handing out tasks to all of their little pawns; he knew everything. Most historians think that he killed himself because he did not want to go through the agony of trial along with spilling the inner most workings of the gang. Charles Forbes was the next one to go. He was brought to trial on a conviction of embezzlement. Yet, he stood no chance. Once his actions went public, he was immediately convicted of embezzlement. He received a one hundred thousand dollar fine and two years in jail.His actions brought attention to the American public. It showed just how distrustful government officials are among the American people. Ironically Daugherty was forced to investigate most of the stuff that was going on during Harding’s presidency. Congress, at the time, said that Daugherty was doing a poor job investigating these cases. Once Daugherty backed Smith for his suicide, which he claimed it was just illness; the Senate launched an investigation on him. Daugherty was not directly linked to anything that the gang did. Yet, Daugherty still resigned his post as attorney general.It was a sketchy move that a lot of people still question. It was not until Hoover’s administration that all of the members of ‘The Ohio Gang’ were out of office. They were a modern day mob, who had all of the resources to get what they wanted. Harding’s presidency is solidified with their actions and should rightfully so. He headed the most scandalo us cabinets in presidential history. All of the members were not the brightest in the bunch but they got what they wanted. Although they paid the price for their actions, they will go down as the biggest bunch of crooks to ever step into such high authority as they did.

Thursday, January 9, 2020

Care Theory Compare Contrast - 1602 Words

Care Theory Compare and Contrast Paper Pamela Morales HCS 350 July 11, 2011 Care Theory Compare and Contrast Paper Jean Watson’s Theory of human caring is based on transpersonal relationships and developing a caring environment that offers the development potential while allowing the person to choose the best course of action. Through interactions with others we learn how to recognize ourselves in others. Watson believes that through these interactions humanity is preserved. John Paley’s article A Slave Morality: Nietzchean themes in nursing ethics criticizes Watson’s theory that caring is central to nursing. The purpose of this paper is to compare and contrast John Paley’s article to Jean Watson’s Commentary on Shattle M (2004)†¦show more content†¦The slaves’ leaders (the priests) initiate the revolt creating new values and attacking the ruling class as evil. The slave class as the nobles, aspires to strength and power, but has no prospect on achieving either. The will to power, the desire to obtain power, is the most important concept to bette r explain the human behavior. Eternal recurrence or eternal return means that the universe has been recurring and will continue to recur in a cyclical way (Internet Encyclopedia of Philosophy, 2009). Contrast between Watson’s Care Theory with John Paley’s article Paley’s hypothesis is that doctors are the masters and nurses the slaves. Traditionally the medical profession has been overwhelmingly dominant with nursing having a position of â€Å"submissiveness†, â€Å"subordination† and â€Å"obedience†. Extrapolating Nietzsche’s ideas, nursing’s inferiority fosters ressentiment. In the same way their priests (nursing theorists) develop new slaves values or a new nursing moral authority. Essentially all values of the medical model become non-moral, the opposite of these values become the paradigm of the â€Å"caring paradigm†: the absence of science, the absence of focus and â€Å"caring† or the absence of clinical detachment. As with Nietzsche’s slaves these feeling of revenge are fuelled by the wish to obtain power; however the political balance remains unchanged (Paley, 2002). Paley believes that the nursing â€Å"revolt† that took place mainlyShow MoreRelatedWhy Should A Health Information Professional Possess A Fundamental Understanding Of The Law?1432 Words   |  6 Pagesparties to the lawsuit are forever barred from bringing a subsequent action raising the same claim or demand. It differs from state decisis in the sense that res judicata applies only to the parties and issues involved in a particular lawsuit; by contrast, stare decisis applies to future decisions involving different parties with similar issues. #7 What is the function of the judicial branch of government? To interpret the law through adjudication and resolution of disputes. Case study ChapterRead MoreLeadership And Management Theory Of Nursing989 Words   |  4 PagesNurses in their profession have evolved beyond giving basic comfort measures to an ailing person to being active developmental leaders in the whole continuum of patient care. Nurses are in the front lines leading and managing other nurses and support staff to achieve the highest form of patient care, and attain the best patient outcomes. Nursing leaders guide others towards set goals and managers pull resources together to achieve those goal. There are different styles of leadership and my styleRead MoreIn this compare and contrast paper I will highlight the differences and commonalities1167 Words   |  5 Pagesï » ¿ Compare and Contrast Paper Jeremiah Barwick Liberty CCOU 201 In this compare and contrast paper I will highlight the differences and commonalities between Larry Crabb’s biblical model of counseling, theories, and techniques of Rodgerian theory called Rodgers’ Client-Centered Therapy (RCCT), Rational Emotive Behavior Therapy (REBT), and Cognitive-Behavioral Therapy (CBT). All of these theories are a form of psychotherapy. Couselors today use techniques such as pharmacologicalRead MoreCompare And Contrastusing Apa Style. Nori Mosqueda Rivera.1010 Words   |  5 PagesCompare and Contrast Using APA Style Nori Mosqueda Rivera Northcentral University The purpose of this paper is to compare and contrast two famous educators using APA Style. This paper will talk about theories of Piaget and Vygotsky in which similarities and differences in their theories will be discussed. At the end of this paper, you will be able to understand the differences and the and similarities between both famous educators. If we take a brief look and compare Piaget s TheoryRead MoreGrand Theorists : Theories And Theories Essay1262 Words   |  6 PagesTheorists Theory is a journey to uncover the past and improve the future. By uncovering and analyzing a discipline’s theoretical journey, insight and self-awareness are gained. According to Meleis (2012), â€Å"Theories are reservoirs in which related knowledge is articulated and organized into meaningful wholes† (p.33). By implementing and analyzing theories, empowerment and guidance for the future is obtained. Meleis (2012) further classifies theories into distinct categories: grand theories, middle-rangeRead MoreEarly Life Experiences Impact The Person Across Their Lifespan930 Words   |  4 PagesPiaget theory ‘Stages of cognitive development’ (1936) and Erik Erikson theory ‘Psychosocial stages’ (1950). Piaget argued that children develop knowledge by constructing their experience and observe with their own ideas about how the thing works.(Burton, L.J., Westen, d. Kowalski, R.M. 2015) He developed 4 stages of his theory: Sensorimotor Stage, Preoperational Stage, Concrete Operational Stage and Formal Operational Stage. At the same time, Erik Erikson proposed a psychoanalytic theory of psychosocialRead MoreCompare And Contrast Leininger And Kubler Ross1575 Words   |  7 Pages Leininger and Kà ¼bler-Ross Theories exist to guide and teach individuals about how and why certain disciplines function. One discipline that has many theories is nursing. Nursing theories help to guide patient care. For instance, Madeleine Leininger developed the theory of Culture Care Diversity and Universality also known as transcultural nursing (TCN), which helps nurses to be culturally competent. There are also non-nursing theorists which can add to a nurse’s knowledge in caring for their patientRead MoreThe Theories Of Sister Callista Roy s Adaptation Theory And Virginia Henderson1729 Words   |  7 Pages The purpose of this paper is to explore the theories of Sister Callista Roy and Virginia Henderson. Sister Callista Roy’s Adaptation Theory and Virginia Henderson’s Need Theory both play an important role in nursing today. Both theorists have written theories that can be used in a critical setting as well as multiple other practice areas. I will compare the similarities of e ach theory as well as contrast the differences. Both theories will be looked at and a plan will be developed to put themRead MoreThe Development Of Middle Range Theory1474 Words   |  6 Pagespracticing nurses started to incorporate nursing theories into their research and clinical practices. The most of the early theories fell into category of â€Å"grand theory†. While nursing researchers initially tried to utilize the grand theory in to their research, due to its wide range of information it made the effort difficult. The development of middle range theory started to emerge in attempt to incorporate in nursing research and practice. Middle range theory extend the understanding of nursing practiceRead MoreStatistical Applications1295 Words   |  6 PagesRunning Head: WATSON AND PALEY: COMPARISON AND CONTRAST Watson and Paley: Comparison and Contrast Penelope K. Gates RNBC HCS350 Jean Watson received her nursing diploma from â€Å"Lewis-Gale School of Nursing† in Roanoke, VA, in 1961. She went on to complete her undergraduate and graduate studies at the University of Colorado. She obtained a â€Å"PhD† in educational psychology and counseling in 1973. Her primary work has been in the psychiatric field of nursing. Dr. Watson has taught many nursing

Wednesday, January 1, 2020

Analysis Of The Poem I Hell And Back - 1411 Words

Audie Murphy, one of the most well-recognized and most decorated soldiers of the United States Army of World War II, participated in two battles which earned him respect and awards. The first, his efforts in taking Yellow Beach of southern France, earned him the Distinguished Service Cross. The second, in a battle outside of Holtzwihr, France, earned him the Medal of Honor. Not only are these events well documented for official records, they appear in his â€Å"autobiography† To Hell and Back, ghostwritten by David Spec McClure with Murphy providing details, along with various sources which include family scrapbooks, the accounts of soldiers who served with Murphy which they gave for his medal citations, and a recently published History of†¦show more content†¦This account, so far, squares with an account by Staff Sergeant Norman Hollen, also of Company B. Not mentioned in Hollen’s account was Murphy’s killing of two Germans who he stumbled across before finding the light machine-gun, a fact which both Smith’s and Graham’s accounts mention . The accounts do seem to differ in that Murphy describes machine gun fire being responsible for Tipton’s death while Hollen suggests it was a sniper . Graham supports Murphy’s assertion of machine gun fire being the cause of Tipton’s death, as he places the blame not on a sniper in the house, but on the machine gun nest which Murphy storms . Meanwhile, David Smith, writer of The Price of Valor, sides with Hollen, claiming a single sniper shot was responsible for Tipton’s death. Two schools of thought appeared in the literature about what occurred and there seems no way of reconciling them. However, Smith claims that Murphy said that it was a sniper, not a machine gun, contradicting the narrative of To Hell and Back. Murphy’s and Graham’s accounts seem to show that he did not use his carbine, while Hollen and Smith both claim that Murphy killed the two Germans who had approached with the flag of surrender with his carbine. Murphy, Smith, and Graham all agree that Murphy carried a German machine gun which he had captured â€Å"like a BAR† and fired it from the hip as he proceeded up the hill. This detail wasn’t mentioned by Hollen, whoShow MoreRelatedAnalysis Of The Poem I Hell And Back 1404 Words   |  6 Pagessouthern France, earned him the Distinguished Service Cross. The second, in a battle outside of Holtzwihr, France, earned him the Medal of Honor. Not only are these events well documented for official records, they appear in his â€Å"autobiography† To Hell and Back, ghostwritten by David Spec McClure with Murphy providing details, along with various sources which include family scrapbooks, the accounts of soldiers who served with Murphy which they gave for his medal citations, and a recently published HistoryRead MoreAnalysis Of Dante Alighieri s Inferno 1556 Words   |  7 PagesThe title of the reading that I chose to do a literary analysis on is Inferno by Dante Alighieri. What was this book about and what message does this particular ancient poem aim to explain? This epic poem was written in the fourteenth century and there were a lot of commentary involved in the story itself. Dante’s Inferno is widely seen as one of the greatest epics to ever grace textbooks. The text itself throughout this story speaks much to the concept of life and death and what the afterlife isRead More Analysis of Satans Speech in in John Miltons Paradise Lost1010 Words   |  5 PagesAnalysis of Satans Speech in Miltons Paradise Lost      Ã‚  Ã‚   John Miltons Paradise Lost is a work of enduring charm and value because of its theological conceptions, its beautiful language, and its updating of the epic to the modern worlds values. Book II of this epic poem opens with Satans speech to his minions in hell, proposing war on Heaven itself. In these first 44 lines, Satan is clearly established as epic hero, but at the same time is theologically/morally denounced by theRead MoreAnalysis of Slim in Hell by Sterling Brown and Power by Audre Lorde1002 Words   |  5 PagesAnalysis of Slim in Hell by Sterling Brown and Power by Audre Lorde â€Å"Slim in Hell† by Sterling Brown written in 1932 and â€Å"Power† by Audre Lorde written over forty years later, are protest poems looking at, and attacking, the problem of racism through the use of imagery, structure, and tone. Through their different uses of imagery and structure, they create their respective tones and take their respective (and different) approaches towards this problem of racism â€Å"Power† is an outcry atRead MoreHow Dante Achieves a Synthesis Between Narrative and Cultural Elements in His Writing1565 Words   |  6 PagesAeneid in their depictions of hell in pagan mythology. Analysis There are a host of specific examples from pagan mythology in the Inferno. For instance, in Canto 15, we see Dante leaving the wood of suicides. The people there do not have a chance to assume a new metamorphosis form due the heinousness of the crime of suicide (Aligheri and Lombardo 72). In Canto 14, we further see that the rivers Acheron, Styx and Phegethon from pagan mythology form the river system of hell that Dante encounters (ibidRead MoreT.S. Eliot Paints a Grim Picture in The Love Song of J. Alfred Prufock1348 Words   |  6 Pagesas ineffectual and â€Å"almost, at times, the Fool† (119). Decidedly pessimistic in tone, â€Å"The Lovesong of J. Alfred Prufock† ironically provides its reader not with a lovesong as its title might suggest but, rather, an intense and unfavorable inner analysis in which the poem’s persona demonstrates anything but self-love. In its 131 lines, â€Å"The Lovesong of J. Alfred Prufock† manages to allude to a considerable array of literary works—among them Dante’s Inferno, Shakespearean plays, the bible, and Marvell’sRead MoreSatan As A Hero And A Villain916 Words   |  4 PagesSatan as a Hero and a Villain (Analysis of Satan in John Milton’s Paradise Lost) John Milton created Paradise Lost out of twelve books of well constructed poetry. A poem depicting and going into detail of the story of Adam and Eve, man’s creation and fall. The poem focuses on the actions of one particular character, Satan. Milton introduces his readers to Satan in Book I as a hero, trying to get revenge against God for throwing him out of Heaven, being banished to Hell. But as Satan carries on withRead More Analysis of T.S. Eliots The Love Song of J. Alfred Prufrock1424 Words   |  6 PagesAnalysis of T.S. Eliots The Love Song of J. Alfred Prufrock   Ã‚  Ã‚  Ã‚  Ã‚  The Love Song of J. Alfred Prufrock demonstrates the effects of social and economic pressure in the life of a Victorian man. T.S. Eliot shows us, in an ironic monologue, how the reality of age and social position paralyzes his character with fear. The poem opens with six lines from Dante?s ?Infernio?. This particular stanza explains that the speaker is in hell and the message can only be told to someone else in hell. TheRead MorePoetry Analysis of Limbo, Blessing and Half Caste Essay857 Words   |  4 PagesPoetry Analysis of Limbo, Blessing and Half Caste I have chosen four different poems of which come from varying cultural backgrounds and have a moral. I will now explain how the writers present their ideas and give the readers an insight into different cultures. Limbo is a poem, which shows us the feelings of slaves on slave ships written by Edward Kamau. This poem tells the story of slavery in a rhyming, rhythmic dance. It is ambitious and complex. There are two Read MoreIs Satan A Hero Or Villain?1258 Words   |  6 PagesIs Satan a Hero or a Villain? An Analysis of Milton’s Paradise Lost The heroic qualities of Satan in John Milton’s Paradise Lost are overwhelmingly masked by his ‘satanic’ and villainous acts which qualify his character to fall into a category of villain rather than hero. Paradise Lost is an epic poem and like all epic poems, requires an epic hero with a tragic flaw. The tragic flaws of Satan are too prominent and effectual to call him an epic hero, but rather these flaws, or evil characteristics